Genomic Feature

m100

ID
ZDB-ALT-980203-427
Name
m100
Synonyms
  • laf (1)
  • lost-a-fin (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
C->T mutation causing a change from arginine at aa position 145 to a stop
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 41532847 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
C->T mutation causing a change from arginine at aa position 145 to a stop
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 145 (1)
Sequences
Flanking Sequence
CAGGTCTGGTTCGAGGTTATCCCCTGGAGGATTGTCAGTCTATAGCTAACGATAATTGGCTGCTGTACTAGTAGGCGAGGTTCATTGGCCAAATTGACCATTACACTTTTCCCCATTCAAACTATACGAGTGACATGTCTTGTGTATTCTACAGTCTTCGTTATTACCCTGTTTATGCAATGACCATAATAATAAGTACATGCTATACATGTGAAACTGTTTCTAAAATGCTGTGCTACCATTATAGAATTATCAGTTATGTCTTTTATATTTTTTGCTTTTTGTTTGGTTACATTTAGAATTCTAAAACACAAATTATTTATACCCCTTTTTGTCTGTTGCTATCATTTTGTGAATGTTTTTGATTTGTACTGTGTTTCTGAAAAGGTCCAGAAGAAAAGAAGACTGTTCATTACCGCGTGGAAATGTTGGTTCTGTTTGTGTTGGGGCCGTTTGTGGTTCTGGGTCTGCTGTCTTTTCTGGCTTTGCTGGTGTGCCGT
C/T GACTCCATCATGGGCGTCTGGAGAGACTGCACGAGTTTGACACTGAACAGGGGGCCATCGATGGGCTTATCGCGTCTAATGTCGGAGACAGCACACTTGCGGTATTGTATTTCTATAGACTACATGAATTGTTTAGTATTTCATAATTTCATTTTATAATCTTTTGTTTTGTATGTTTTATCACTTTTATATATTATTATTATTATTATTATATGAACTTATTTTTTTAGCTCAAGTTATTCATTTATTGACGGTAGATTTCTATAAACTACATAATTTCTTTTATAATACAAATATCAGGTCTTATGGATGTTTTATCACATTTATATTATAATTAATATATGAAGTTATGGGGGGGTTGTTATTTTAGCTGAAGTTAGTCATTCATTGATGCTAAATTTCTATAGACTATGTTACATTAATTGTTTTTTATAATACTAATAATTGGGTATTTTGTGGACGTTTTACCACTTTTTGTGGTATAAATAACATTTTAAAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations