Genomic Feature

t1

ID
ZDB-ALT-980203-1829
Name
t1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
The t1 allele is the result of a premature stop codon at position 68 and is most likely a functional-null allele.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 47416639 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
The t1 allele is the result of a premature stop codon at position 68 and is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Arg>Stop at position 68 (1)
Sequences
Flanking Sequence
GTGCACATACTTCCTCAACTGCTTCCATGCCAAATGATACAGTTCCACGATACTAAGCAGCAGTGACACCGCTGCTACTGCTAGCATGAAGACAATGAACACGTTCTTCTCTGTTGGTCTGGAGATGTAGCAGTTGACCGGATGTGGACACGGAGGGGCTTTACACACATAGAGTGCACTAAGGAAGACTCCGTAGATCAGGTACTGGATTATGATGAAGATCACTTCCATCACAGTGCGGATGAGGATGCTGAGGACGTATGTTTGCAGCAACGCACCCTTCAATCGTACCCTCCTACCTCCACCTTCGTCCTCCTTGTTCTTGTCATCTTCTGGGTACTTTTCTCCATCTCTCTGCGCTCCTTCATCATCCAGCTCTTTCCTCTTCTTCTCCTCTCGGCGGACGATATGCATTGCGTGCCCCATGTAGATCAGAGAAGGTGTAGACACGAACACGATCTGGAGCACCCAGAAGCGTATATGCGCTATAGGAAAGGCTC
G/A GTCGTAACAAACGTTCTCGCAGCCGGGCTGCTCTGTGTCGCAGGTGAAGTCTTCCTGCTCGTCCCCCCACGAGGATTCAGCAGCCGTGCCTAGTACCAAGATCCGGAAGATGAAAAGAATAGTGAGCCACACCTTTCCCACCGAGGTTGAATGCTCCTGGACTTCTTCTAGAAAGTTCCCCAGCAGACTCCAGTCGGCCATGCCTATTCAGAGGAGCCTGAGGTGGAAATAAGAGGTAGTGTGAATGGAAGGGAGAAAGTAACCGTTTTATACAATGATTTGCCTAATTAGCCTAATTTGCCCAATTAACCTACAGTTGAAGTCAGAATTATTAGCCCCCCTTTGCATTTTTTTTCTTTTTTAAATATTTCCCAGATAATGATCAACAGAGCAAGGAAATTTTCACAGTATGTCTGATAATATTTTTTTCTTCTGGAGAAAGTCTTATTTGTTTTATTTTGGCTAAAATAAAAGCAGTTTTACATTTTTTGAAGCCCATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations