ZFIN ID: ZDB-ALT-980203-1788
Genomic Feature: ty119
Synonyms: Y119A (1)
Affected Genomic Regions: gli2a
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 9: 37294015 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T at position 3148 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Arg>Stop at position 929 (1)
FLANKING SEQUENCE (GENOMIC)
CAATGCTTAATCAGCTACATGAGCGCAGAGATAGCTCCACCAGCACAATGAGCTCAGCATATATAAGCCGTCGGTCCTCTGGCATTTCACCTTGCTACTCCAGTCGTCGCTCAAGTGAGGCTTCGCAATTTGGAGTCCGCAACAACAATGTCAGCTCAGCAGACTCCTATGACCCGATCTCCACAGATCTGTCACGTCGTTCCAGTGAAGCAAGCCAATGTGGTGGTACAGGTGGGCTCCCAAGTTTACTAAATCTCACACCAGCTCAACACTACAGTCTTAAGGCGAAATATGCTGCAGCCACTGGGGGTGCACCACCAACACCTCTGCCCAACATGGATCGCATGAGCCTTAAAACTAGAATGGCCATGTACAATGACTCGCAGGACAGTTCAGCACATTTGCACCATGCCCAAGGTGTAGTCAACTCAAGACGCTGCAGCGACACTGGGTACGGTGCCCCTGGCATAATGCCTCATGAAGTTCCGGCCAATCTTCCA
C/T
GACGAGCAAGCGATCCTGTTCGTCGTACAACTCTTGACCCACTCTCCTTGCCAAGAGTTCAGCGGTTCAACAGCATCAGCAACATGAACCTATCACGTCTGCCTGCATATGATCGACGTGCTTTCAACATGCAGAACAACACTTGGTCTGATGGAAGCTTGCACCGTCATCCCTTCAGCCAAAGGCCACCTAGCATATCAGAGAACATTTTAATGGAAAATATGGCCACTGATGGAGGAGATCAACAAGGGGATGATTTGGTGCTTCCCGATGACATGGTACAGTACCTCAGGTCCCAGAATGGTAACTCAAATCACGATTCTGGGATTTCTGTCAATGGCGGTCATGCTCTAGAGTTCCATGGTAATATGACCTCCCAACAACAACAGTTCTATGGGCAACGCAGAATGGGCATGGCAAGCATCAATGGAAGTCACGTAGAGCCTGTTCCAGAACAAATAGCTGATCCGCAGGGCATGAACAAAAACAACATGCCTGTG
Comment Citation
"In yot ty119 C3148 is mutated to U,
changing Arg-929 to a stop codon."  ...
Karlstrom et al., 1999
OTHER ty119 PAGES No links to external sites

CITATIONS  (60)