ZFIN ID: ZDB-ALT-980203-1780
Genomic Feature: tu285
Synonyms: AU85B (1)
Affected Genomic Regions: tbx1
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 5: 15204137 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T at position 364 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Gln>Stop at position 122 (1)
FLANKING SEQUENCE (GENOMIC)
GAAAACCTTGCGATACGCGATCGACACATTATCTATTGGAGACATCTTGAAATTACTTTCTATATAGACGAACACTCACTTGCATATTGTTGCTTTTGAACTCGAGTCCAGCGCAAATTGTAAATCCAATTTTTGGAATGATTTCAGCAATATCAAGCCCGTGGCTGACGCAGCTGTCCCATTTTTGCGATGTTGCAGCCTTCACGACCAGCAGCCTGAGCAGCCTCAATACGCCCGGGAGTTACCATCTCTCTCCTTCTCCTGGGGATCCATACAGCCATCATGAAAGCCAGTTTGAGCCGTGCCCGGCTGCCCAGCACGCCTACAACTATTCCGGATCCAACTCAGCACAAGCCCCGGCACAAGGAGACAGCGGGACCTCCAATTGCTCCTCGTCGTCGTCAAGCTCAACGCCGAACAAAACGCTGGTGAAAAAGAACCCTAAAGTAGCCAATATTAATGTACAGTTGGAAATGAAGGCACTCTGGGATGAATTTAAT
C/T
AACTTGGGACTGAAATGATTGTCACAAAAGCCGGGAGGTGAGTTGACATTATGCTGAAGATTGTTTGACATCTGGTTGTTGTTTTAACAATTTCTCAACATTGATGTTAATTATTCTTGTTATTGTTGTTAATTTTTAGGTTTTATTTCGTTTTATTCATTTTTTTAATTTAAACCCCTACAAACTTTCTATTTAGTGTAGCAATCTAAATGCATCTGCATTTCAAAATGAGCCTTTTTAAGTAGCCTATCTTCATCGTCAATGCACTTGATTGGTGGTAACAATTTGTTTTGTCAACTGAAGTCATCTTATAATCATACTTGCACTAGAAATACAAATTTATCATCTTATTGTCAGTTCATTGTGATCAATTGTGAATAAATACCTTTAACATAAGCTTAGCACAATCATGGCCATTTAAATTAAAGTGTAAACTGCCTATTTACACAGTGATAAGACATACAGCGTAAGATACAGTATATTTTAGCCCACCTGTGTGC
(1)
OTHER tu285 PAGES No links to external sites

CITATIONS  (16)