Genomic Feature

ty31a

ID
ZDB-ALT-980203-1596
Name
ty31a
Synonyms
  • ty31z (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Other Pages
Note
G-to-T transversion transforms Gly 75 (GGC) into Val (GTC).
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 13: 29774023 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
G-to-T transversion transforms Gly 75 (GGC) into Val (GTC).
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Gly>Val at position 75 (1)
Sequences
Flanking Sequence
AAGGATATGTTTTCTAGGAAACTGTTGTAGATTTTTGAATTTTTTGAAATATTTTTCAGCTATCAAAAGGATCTTATAAGGTATTCTGCACTTTAAATGTTCCTTAGAAATTATGAGATATGTGTTGGTGGCATGTATTAATCGTGGGGTGCATGGGACACACATCAGCCTCTGAGGAAACCGTTTGATAAATGGATGATTGCAATTTTTCAGATCGCAGCCAACAAATGTTAATGTTTCAAGACGCTAAATCTATTAAATATACGTAGTAAAATAGAAATGACACACATTTCCGTCAGTAGGATTTGGGAAAAAAATTGAAATAAAGTTGTGATTAAATGTATAGATTGTGTTATCATTTATGTCCCGTATATCACAATTTATAAATATGCCCAATGCCACAAGCTAACACAAAACCCGCCATTATAGCTTTCATGGCTTGGCAAAATTATTTTAAATAACGTATTATCGTTTATCTTTTCTCAGATATTATGAAACCG
G/T CAGTATTAAACCTGGAGTTATTGGGGGGTCCAAACCAAAAGTGGCGACGCCCAAAGTTGTGGAAAAAATCGCAGAATACAAGCGGCAAAATCCTACAATGTTCGCCTGGGAGATCAGAGACCGACTCTTGGCCGAAGGCGTTTGTGACAACGACACAGTACCAAGTGTTTCATCTATAAACAGGTAAAATTCTTTTTTTTTTTTCAAATTTTAAATTAATTAGAAAAACACTGTCAGTGATGCTATTTTCAAAATCCATTCTCTACTGACCTTAAACAGTTGCTGTTATTAAAACAACGAATCAAAACAGTGACGGCTAAATTATTACCAGTAAATCTAAAATCATTTAAGCACTTATATATTTAAAAAAAACTACTTATCCTTTCTAAATAACGGTGTGTATTTTATGGGTGATGTTTTTTTTCCGTTTTTAATTCTTGCTCTCGGGGTGGTCTCAAATGTGCAATTCAATCCCAAATCTGTCCACAGCCTGCAGAGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations