Genomic Feature

ts294e

ID
ZDB-ALT-980203-1553
Name
ts294e
Synonyms
  • AS094E (1)
  • ts294 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 6: 7263580 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Premature Stop (1)
Protein Consequence
Gln>Stop at position 371 (1)
Sequences
Flanking Sequence
AATTGGTTGAGTTCAGGGAAGGAGGAGGGCAGGTCGGCCGATTGGCCGGTCGCGCAGTCAATCATCCGGTCAGTCTGACATCGGCCTCTGGTGGGTTCACGCGAGAACAGAGCGGGCGCGAACCGCACTTGCGAGAGGCGTCTGAGGTGCGAAAAAGTGCACAACAGCGGCCTCTCACGGATTTGCAAAAACAAAAACTGCAGCCGTACGTACCCACCGGGACGTATTCCGTGTTCTCCAGAAACGTCCGCGGGACTACGTTTCCACAATGAGCCTGGGTTGAACTTTGCTGAATTTAAATTTAACACATACAATATATTTACCAAAATCGTGGATATAATGTGGTTATGCTCTATCCACATAATCACTTTGTACTTCTCTCTTTATAGGAGCTGCTGAAACTGCAGCAGAAAAATATACAGGAAAGCATGCAGTCGGTACAGACACAGCCCAATGCATCAGCCAGCAATGAACACTGGCAGGAAGTCGTTAAACTCCAA
C/T AAAAACTCCACAAACAGGTAAGATATACAACGTTCAGATGAAATGTCTTGACCACTATGCATTTGCTAATATCTGGACTTGAATTTGTTTGTTTTAGAGAGGTCTGAAAATTTGCAGATCTTATACATGTATACCCTTATAGAAATCTATGTATAGTAATCTATGTTTTATCTATAACATGGCCTGTAGGGGTATGAACCTACACTGGTCTCACGGTTCGGTTTGGTTATGATTATCATGTCATCGATTCAGTTCAATTCAATATCTCTGTGCATCAAGGTGCATTGACGATGCTTTTCATCCATAATTATATTTTTTTCTTCACAATACGAAGTGGAGGAAAGTCCCCAGGGTTCAAGTATCTTGGGGTTTTGCTTACGAGTGAGGGAAGGATGGAGTGTGAGATTGACAGGTGGATTGGTGCAACGGCAGCAGTGATGCGGTTGATGTATTGGTCCGTTGTGGTAAAGAAGAAGCTGAGCTGAAAAGCAAAGCTCTTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations