Genomic Feature

tm285

ID
ZDB-ALT-980203-1548
Name
tm285
Synonyms
  • AM085B (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 7: 27811744 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Glu>Stop at position 499 (1)
Sequences
Flanking Sequence
GATATAAAGATTTGACATTAATCGTGATTATTATCGATATCGACTGATATGAAAAAAATTAGCGTGATAATTTTTTTGGCCATATCGCCCAGCCCTACTTTTTCTGAGACACTTCTTTTGGCATATTCAGTTTTCCACATAGATGGCATTAGTCCTGGTTTAAATCTGCCGCTCTGTGTTTGCAGTTTTCCCCGCTTTTGAATTGCACAATTTGGATCATTTATTAAACAATTAAGACAAACTAAAGGAATATGGGTTTTATTTCAATATGCATATAAAATCAACATAACCTCATTTTTTAATTAATGGTGAGGATGTTTCTTCAGCCAGACATTGACCATTACTGTGCTGCTGCAAATAACAGTTGCAATAACAAAAATTAAGATATTTAAGGCCAAGTTCAAAGTAATTAGAAGTTTTTTTTTTTAAAGCTTTTTTTTTTTTTTTTTTTCCTTATTCAGATTCCAATTGTTGAGAATGAGTTGAAGAAGGAGGCTGGA
G/T AGGTGAAGCCTGAGGAGGAGGTGACCGCAGCTCCAGCTCCTAAACTGGTGACAGAAATGGGCACATACGTAACCCAGAGTGCCCTCAGCACCTCCAGACCATCCAAAAAAGAAGAGGACAGGTGATCATTCCTTATGCACCAGATATTTTCCAACAAACACTTCAATACAAGCACTCGGATAAATAGTGCTAAACTAACTTTGATTTGTTATGCCCTCTATTTAATGCTGTTCTCTTGTGATTCGAAGTGCTTCTTTTATTTGTGAAAGTGGGCATACGCATTGTGGATTGTGATGGTCAGAGGACCTTATGTCCGTGCACACGTCTTGAGTGAGTTTATGAAAATATGCAAATTTTATGACCCTGCAAATTCTGCAGCAACCGAATAAAATGCCGCACCGAAAACATTGCTTACAGAGCCTCTTGCTCTGTAATTGTACACAACATTAAGGTTCCTTTTTTTTGCACTGGGGAAACCAACACTCCACGTCACCATGTGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations