Genomic Feature

tx226

ID
ZDB-ALT-980203-1302
Name
tx226
Synonyms
  • AX26A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 36516517 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
The point mutation TGG (W234) to TGA (Stop) results in the truncation of the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Trp>Stop at position 234 (1)
Sequences
Flanking Sequence
CAGATGGGCTCCGCTTTCTCAGATGCACCAATAAGGAACCGGCGCTCGGGCCCACAGGCCTTTAGACTCATGCAGCTTCACAACAATGCTGTTGGCAGACAGGTAAAGCCTCAACCACATGCTGGATTTCCACAGAAGACTGGCATCATTCACTGTAGACATAGCAGGGTTCCATTCAATTCATTCAGGTTGTCTCAACACAAATCTATTAGGTGACTTAACAATCTGAGTAGATTGAACATAAAACAATCGTTGTCCCAAACATAAAACAACAAGTTGTCCCAAAAAATCTTAAGAGTTGTGTTGATTAAGCTCATTTTACATAAGTAGCATGAACAGGTCACAGTAAATTAATAATGAAAATAGTAATTATTTTTTTGAGTGTTTCGATCAGTATCATGAATCTGTGTGTTCGTGTTTGTAAAGGTGCTTATGGACTCTCTAGAGATGAAGTGCAAATGTCATGGCGTTTCTGGCTCATGCTCTGTAAAGACCTGTTG
G/A AAGGGTCTTCAAGACATCAGCACCATCTCCGCCGACCTCAAGTCTAAATACCTGTCGGCCACCAAGGTGATTCCGCGTCAGATTGGCACACGCCGGCAGCTTGTGCCCCGAGAGATGGAGGTGAGGCCGGTTGGAGAGAATGAACTAGTCTACCTGGTCAGCTCACCGGATTACTGCACACAGAACGCCAAACAGGGGTCACTGGGGACCACAGACAGGTGAGATTGACACGCATCATCAATCAAGATTATTGATCACTGATGAGTTGAGAGGGAGCTATCAGTCTGTAATGAATGAGGGATTATCACTGATCCCACAGACGGGACAGAGCACAGGGTGAAAAGAGGCACATGAATGGAGTGGGTTAAACATTGTCAAGGCGCACAGGCATGAAAACTGATTCTTGAACACAAATGGCCTCAAATGTTGTTGTTTGACTTTTTGGCCAGTGTTAACGTACACCATCAGGGTCTTACAACAGGGTGTTCGTGGGGTCTTAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations