ZFIN ID: ZDB-ALT-980203-1289
Genomic Feature: ty219c
Synonyms: AY19C (1)
Affected Genomic Regions: krit1
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 19: 45991528 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A in Exon 15 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Tyr>Stop (1)
FLANKING SEQUENCE (GENOMIC)
AACCCTGCATTCATGAATACATCCTATTTGTTCACTTTTTGTGCATTTTTTTTATTAAAATGACTGTTCATATTTACAACAACGGTTAAAAGCACAAGTCTATCATGACATTATAAAATGCAAATAATATCAGTAAGAAAATATTACATGGTAAACACATTTATAATATGTATAACTGTCTCCTTTTGGTATAAACAACATTTAGTTTTCTGACAGCATAAGAATAAAAACTAAAACTAAAATGAACAAGCTTGTGTGTGATTTGGTTACCCATACGCATATTTATCAGACACAGCTCTGTCGTTTGGTGCAATTTGTCCACTCAGCTTCATCAGCAGCTTCACGATAAGACCAGCCTACAGAAAAACAACACAAACGCCATTAGGTTCTAGTTCAACTTCATTTATGAGGCTCAATGAATGTAGAGATGTGAAGCAGGGGCGGACCTGTTTGGTGTGAACGACAAAGTTCTTCTTGTTCTCCAGACTGTGGATTTGCAC
G/T
TATTGATCAGCCTGACCCAGCTGCCACATAAATGTCCCATACTCCAGACTGAGGTGAAGCACCTGAGACAGACAAATGCAGTGAAAACATGCCACTTTATTAGGTACACCTTACTAGCTGCCTTCAAAACTGCCTTAATCCTTTGTGGCTACTGGAAATATTCCTCAGAGATTTTGCTCTTCATCATGCATATTGACCAATGACTGTAAAAAATATGGACGACGCGACAGCCCTTTTTCCCATTGAACGCCTTGAGGGCAAAACGCCTGCTTGACGGGCACAAACTGTCGCAAAAGACTGCTGAAATTGGAGCCAGACATGCGCAGAAGGATTGTCTGATGGAGCCAGAGGAGGAGCCGCGAAAATGAGCAGAGTCGAGCTTCCAATCAAACGCTTTATGTAAAATCAACTACGCCCCCCGAACTTCTCAGCATGCGTTTGCTGTCATATCAACACAAATGGATGTAATAACGTTAACAAATATGAGGGTTTTATATATT
Comment Citation
mutation is predicted to cause loss of a C-terminal portion of the Santa  ... Mably et al., 2006
OTHER ty219c PAGES No links to external sites

CITATIONS  (16)