ZFIN ID: ZDB-ALT-980203-1102
Genomic Feature: tb210
Synonyms: AB10C (1)
Affected Genomic Regions: rerea
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 23: 22904619 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 361 (1)
FLANKING SEQUENCE (GENOMIC)
TTGCTCTAACTGTAAGCAAACGGGGTTGTAATTGTAGTACTTTGCCCAGGCATCAGGCAGCTGTTTGAAGTGTGAGCGTGCAAATTGTATGATCAGAAAGAAGTGTGTTGTGATTCCTCGTAACTTATTGAAGTTCAGTTTTGGCTTTGAACTTGGTTTGCAACCCTCATATAAGCATATCGCATTGCTGAACTTTCACTAAGATTTCAGACGAGCTGCCATTGCATTTTTACTCCGCTGTGGTTTAATCTCAGCTTCTATTCCTGCTTTTGTTGTCATTTCCCCTCTTCTTTTTTTTTTTTTTTTTGCTGTAGCAGAGCTGTGCTAGCACAAGCAGAGATTTTCAGATTAACATTGTTTTCTTCCCTTTTGCGGTTCACAGTGTTTTGTATATGTAGTTCTTGATGTCAGTTGTTATGGGTGCTTAAAAATAAAATATTAACCATCTTTCTCTTTTCTTTATCCCTACAGAAACGCTTCATAAAGGGTTTACGGCAGTA
C/A
GGGAAGAACTTTTTTAGGATTCGGAAAGAACTGCTCCCTAACAAGGAGACGGTAAGTCATTTTTTTCCTATTTGTCATCGCTTCTTTGACACTAAAACAAGTTAACTCCTTTTCAGTGTGGTTTCTCGTGTTTTGAAATTGAAGCCATGCCTTAGTGGTTTTGAAAACAGCGAGGTTAAGGAAAGATTGAAAGCCATAACTTACACATGGACTTGAGTGCATGAATATTAGATTTAACAGTAAGTTTGTTTGGTGATTGAACAGGGGCCCTGAGACAAGATGTGTTTAGTCAAAACAGAATCATTACTGTTTATATAATGTTTAGTTACAGTAAAAACAGCTACACACACCCCTGATTACTGATGCCTCAGAGAAATAAACTCAAGTTCAAAGCAATTTATTGTTAAGCTTTTTTTGTTGAGCACAATTCGGGTAATGTGTGACATTTTTTAAATGACCGAAAAAATATAATTTTACTTATTAACTCTTTTTTTATTATT
OTHER tb210 PAGES No links to external sites

CITATIONS  (11)