Genomic Feature

ty86d

ID
ZDB-ALT-980203-1093
Name
ty86d
Synonyms
  • alf (1)
  • another longfin (1)
  • dty86 (1)
  • Y086 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
Mapping and sequence analysis showed that the alf phenotype is due to a missense mutation in kcnk5b (F241Y).
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 9237311 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
Mapping and sequence analysis showed that the alf phenotype is due to a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Phe>Tyr at position 241 (1)
Sequences
Flanking Sequence
TGCTTTTCTGAGTGCTTGTCATGCTTATTATACTTACTGTTTTCTATACAAACTATGACATTCTATTTATGTACATGAAAATGTATAGTTGACTGAACTGTCATCAAATTTAAAAGTCATTTAGAGGTCAGAAAACCTCTGCCTGCTTTTGGACCCCTGTGGAAAAGAGTTATAGTTTTAAAATACGAGTTTGATTGTCCTCTGTTAACCTGAGAGTGCAAATCTTGGGTTGCAGTCGGCTCACACGTGAATCTACTTGCAAGTGCTTGATGCATTGCTTCCTGCAATTGTGACTCTGTAAACATATGCAGCTTAAAAACAGCCTCCACGTGGTGTAAAAATAGTGCTAGATAGGCAAATCAAACTGGTTAGTCCCGTTTTGAATAAAGATAAATCACTTTGTTTCCATACAGGGGTGGACCCATCCGTAAACTACCCCACTCTCTACAGATTCTTTGTCCAGCTATGGATCTACCTGGGCCTTGCTTGGTTGTCATTGT
T/A CTTCAGTTGGAACGTGCATATGGTGGTGGAAGCTCATAAAGTTTTAAAGAAAAGGAGGATGAGACGCCACAGGCTGCCCACCGATGACGTGCCGGAAAAAAAAGAAGTGAAAAAAACACCAAAGCCACCTCCTCGCTCTGGAGTCATTGACATCTTTGAGTTCATGTCCGAGAAGGTCGAGGACTACAGCGACGTTATCCGAGCTATCGGAGCAGACGAAAAGAGAAGGAAAAAGAAACAGGAGGAGGAACTGGCACGATCCAAGAGCTGCAGTGACCTTTTGCAAGGCCTGGTCATCCCGCTTGATCACTCTCCTCGTCTGCAACGGCGGTTCAGTGTCAGCGCCAACATGTGCATGGCCATATCTGATGAGTCTGTGGATGGCCTCAACAATAACAATTGCAAACAAGAGGATGACACACTAACTAAAGTGCGCCATAAAGACCAGAAGGTTAATCGAGAGAGAGCGGAGAATCCTGCACGTTGTGCATGGGACTCTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations