Genomic Feature

ug701

ID
ZDB-ALT-210820-2
Name
ug701
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Neerman-Arbez Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 1: 10070079 - 10070088 (GRCz11) (1) Details
Nucleotide change
CGTGCTCAAT/ACA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3 bp inserted / 10 bp deleted in Exon 2 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CCTCCACCAGGAGACGTCGAATCTTCTCAATCTTCTTGAGGAGATCATGGTCAGCTTTGTCCATGAGGCCTTGAACTCGGCAGCCAGATGGACATTTGCTTCCCTATATTGAGGATTGAAAGAAACATTTACTGCAACAAATTTGTTGATAGAGATTTTTGTGTTTTGTCTAATTATTGAGTCAATATTTATGACTTATATAATATATAGTAATAGGTAGTATATGAAGACTTCTAAATGCCGTCTGAAATTTTTTATCCAGCCAACTCGAATGTTTTACACTCAATTGTATGGGCGTAATCAGTGGTTATCAGCTGACAGATATGGGCCAGTAGGGGTCCTCTGCGCATATAGGCTTAGAAGGCTGTTATCATTCATCCACATGATGGTGGATGGATGGAATGAACGAAGTGAAGAAAAACAGTGAGAAACCCATACCCAGTCATCATCGGTACACCCTGGCCATTCTTTTGTCTGGCAGGTGTCTTGTGCCTTGAAGC
CGTGCTCAAT/ACA AGGACGAGCGCCTCTAGGGTTCACCACTGTGTCCTCCTCGGCCTAAAAAGTAAGTACTTTATAACTACTTAGGTCTGCCAACATAGGCCATTTTAACATACAGTGCTCAGCAAATAAGTACACCCTTTTGAAAACTACTATTTTATCCATTTCTCAGTGAATGTAGTCAAGAAAATACATTTAAATTGAAACATGTCATTCCAACAAAATTTGATCTTTTTTATTATTCTATTGATTTTTAATATTAATTAAAATTTTATAATTTTTTTTTTTATTAATTTTACTATATTTTAACTAATTTTTAGACTTTGATCTCACGATTTTTTTGTCAGATTAGTTCCAGTTTTGGCTTAAATAAATACTAATCTAATGTATATGCACAAATATATTATTGTAGAGCATCCTATACACTGTAAAAAAAAATATACAGTTGAAGTCAGAATTATTAGCCCCCTTTGAATTTTATTTTCTTTTTAAATATTTCCTAAATGATGTTTAAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations