ZFIN ID: ZDB-ALT-200505-1
Genomic Feature: rmc105
Synonyms:
Affected Genomic Regions: znf408 (1)
Type: MNV (1)
Protocol: embryos treated with CRISPR1-znf408
Lab Of Origin: Molecular Therapies for Inherited Eye Disorders
Location: Chr 7: 38749087 - 38749091 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp inserted / 5 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AAAGTGCACTCATCAGCCAAACGCATCTACAAACGACACGACCCAAAGAACAAGCCAGATCTAAGCAGCAAGAAAAAGCTCTTGAATAGCAAAGACGACTTAATGCAGCCGTTGACAGTTAAAGAAGAATCCAGCACAAAGCAAAACGGGCAGGATTTCCCTCCCTTCAATATCCGAGAGAGGAAGTACAAATGCGAGGAGTGTGATAAAAGCTTCTTTCAACTGTGCCATCTGAAGAAACACAAATACACTCATCAAAATCAGAAGCCATACACGTGCACAGAGTGTGGCAAGTCCTACAGCTCACATGAGAGCTTCCAAGCCCACCTGCTAATGCATCGTGGCCAGAGGCCCTTTAAGTGCGAGCAATGTGACAAAAGCTATGGCTTGAAACGGGACCTCAAGGAGCACCAGGTTCTCCACTCAGGAGAGAAACCGTTTGTCTGTGACATCTGTGGAAAAGCATTCGCTCGTCGGCCCTCGCTACGAGTCCACCGAGA
GATCC/AATCT
ATCGGACAAAAGAGCCAGACTACCAGGCTTTAAAGGTCAAGTGTCCAGAGTGCGACAAAGAGCTGGCCAATTCGGGTTCTTTGAGGAACCACATGCGTCTGCACACCGGAGAGCGACCGCACATCTGCCCGCACTGTAATAAGTGTTTTCGCCAACGTGGGAATCTGCAAGGACACATGCGCATCCACACAGGAGAAAAACCTTACAGGTGTGACCACTGCGACCTGAGATTTTCTCAAGTACCCGAACTGCGTCGGCATCTGATTTCACACACGGGTGAGGTGTATCTCTGTCCTGTCTGTGGTAAAGCTTTACGGGACCCTCACACGCTTCGCGCTCATGAACGGCTCCATACGGGAGACAGACCTTACAAATGTGAGCAATGCGGGAAAGGGTACACGATGGCAACCAAGCTACGACGCCACCTAAAGTCCCACCTGGAGGAGAAGCAACACGTTTGCCAGGTGTGCGGAGCAAAATACTCAATGATGCAGAGTCTA
OTHER rmc105 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous znf408rmc105/rmc105 (TL) znf408 ♀+/- ♂+/-
Heterozygous znf408rmc105/+ (TL) znf408 Unknown
Complex znf408rmc105/+; la116Tg (TL) znf408
znf408rmc105/rmc105; la116Tg (TL) znf408

CITATIONS  (1)