ZFIN ID: ZDB-ALT-200218-17
Genomic Feature: a317
Synonyms:
Affected Genomic Regions: ptprfb (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR4-ptprfbCRISPR2-ptprfbCRISPR3-ptprfbCRISPR1-ptprfb
Lab Of Origin: Schier Lab
Location: Chr 2: 17757180 - 17757183 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 4 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TTGTGACATTTAACATTGTCCAATGGGATCTCAATAGCTGCAAATTACGTGTCTAACTTACTACAGGTTACACCCCTTCATGTTATGCCCCTGTCTTGCAGTCCGCAGACAGATAGACTAGACACTTGACTAGGTTTGGCTAATAATAAATGTGATAAAGTTAATATGAACAATTAAAACAAAAAATATTAAATGACACTTTGTCATATAAGCATTATACATTATATTTATAACACATATTTGTAGAACAATTATTACTAGTTAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATGTTAGTGTCATTTTCCAAGTCTATTTACACCAACATCTCCTATCACTCTTCTACCTTCCTTCCAAACTCAATGTCAACCCTCATATAAATAAGTCAGAAATGTATAAGAAAAGTCATAAATGTAAAGGGGGGGCTGCTGACCTTCCAGCACGGTGAGTTTGGCGCTGGTGTTGATTTCCCC
CAGG/-
CTGTTGGTGGCTGTGCACTCATAGATGGCCTCGTCTCTGTGAGTTCGCAGTGGCTGAATGCGCAGAACTGAGCCCGAACCATCATCAAACTCAATCACCTGCCAAAGAAAGACACACCGTCAAACACTTTTCTCTCTTCTCGCCTTAAAATTTACAGCAAAGCCTCAGACCAGATCATATATCTTCAAAGAGAGTAGGGTCTTTAATCATGTCCTTCTGAACTTTCAGCCAACTACTGTCTTGAGTTATTCTGCAAAAAAGCTGCCACGTCTCTCTCTGAGGCAGATACTGTGACGGCTATTGGACAGATAGGCTTGATGTTTCTCATGAGTGACAAATAATGTGCTGTTTGACACTGTACTCAAGTTTCAGAAGGCCTGAAGTCAACAAGGTGTGTACAGGGGTGGAATACGGGACATTTGAGGGATACATTAAGTGTATTTAGGCCAAAGTCTTCTCCTCCTACACAGAGATCTTTGTGCTTCATTTAGGTTAAGTGC
OTHER a317 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ptprfba317/a317 ptprfb ♀+/- ♂+/-

CITATIONS  (1)