ZFIN ID: ZDB-ALT-200204-15
Genomic Feature: a214
Synonyms:
Affected Genomic Regions: sbno1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR3-sbno1CRISPR2-sbno1CRISPR1-sbno1CRISPR4-sbno1
Lab Of Origin: Schier Lab
Location: Chr 10: 44353867 - 44353873 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
TGGACACAGAGATTTAGTTTTCAGCCCGCCAGCCTCAGCGCTTCTGGTGACCTGCCTTTCCATTATAAAACTGCCACGTTCAAGGTCTGATTTCTTTAAAAATCAGTGATCTTCGCTGTCTGATACAGAATATAAAGTGGGTCTCAGACCAGACAAGAAGCACAGCATTCAATTATTTCCACCCGCCATGTCAAAGAGGGAGCGCTCGGCTCTTCATTCTCCTTAATTCAGCGGGAACAGTGAACCTGACAGTGGGTTAACAGAGCGTTGCACTCCTCAGCCGACACTGATTCTACATGCTGAATGGGGCTAACATGATCCAGCATTAACCTGACGGCTCGGTGTGTACTGGCCTTTAGTGGGCCACATGTTAAAAAGGTTGGTAACCAGTGTGCTAAAGGAACCAGACCCCCTCCTGCTAAAGCTTGTGTGTGTGTGTGTGTGTGTGTGTGTATCACTCACTAGTGCCAGTGGCGGTGGCGACAGGTGGTGCGATGTCT
GCCGGGG/-
GCTTCAGCTTCATTAGCTCCCCCAGACTGCTGCTCTTCAGGCTGCTGCTCCTCAGCAGGTCCTTCAGCCGGATCTGCTCAGTGTTTGCCGGAGCCGCAGTGCAGACGCTGGGAGAAGCGGAGCTGCGCTGTGCTGGAGAGGAGCTGTGCAGCACCTTGGTGACGGTGATGGTCTGTCTGGTGCTGCTGCCCGTCGAGGGTTTGGAGACCACGATGGTTCCCAGCGAAGGCAACTGATTCAGCTGATTCAGCACAAAGGTGGTGGTGGAGGGCTGAGGCTTCTCCTGCACACACAGGTTACGCACGTCAGTCTCATAAACAAAAATACAGTTAATCCATTATTTTACACAAGCATTTACCTGCTTATTCTGCTTTACCCACGCTCTCACCCGCCTACTGTTTTGCACACTTAAAATACTGAGTTCAAAACACGGGCTTAAACGGAGAAGCCAACATGAGAATGTGCATAAATACAGAGTAGGATAAACCCTTTAGTTCATA
OTHER a214 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous sbno1a214/a214 sbno1 ♀+/- ♂+/-

CITATIONS  (1)