Genomic Feature

mi4007

ID
ZDB-ALT-200122-5
Name
mi4007
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with
Lab of Origin
Shavit Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 1: 10070066 - 10070067 (GRCz11) (1) Details
Nucleotide change
-/GAATCATGGACAAAAATGTCTTGAAG
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
26 bp inserted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TATAGTTTCTGGCCCTCCACCAGGAGACGTCGAATCTTCTCAATCTTCTTGAGGAGATCATGGTCAGCTTTGTCCATGAGGCCTTGAACTCGGCAGCCAGATGGACATTTGCTTCCCTATATTGAGGATTGAAAGAAACATTTACTGCAACAAATTTGTTGATAGAGATTTTTGTGTTTTGTCTAATTATTGAGTCAATATTTATGACTTATATAATATATAGTAATAGGTAGTATATGAAGACTTCTAAATGCCGTCTGAAATTTTTTATCCAGCCAACTCGAATGTTTTACACTCAATTGTATGGGCGTAATCAGTGGTTATCAGCTGACAGATATGGGCCAGTAGGGGTCCTCTGCGCATATAGGCTTAGAAGGCTGTTATCATTCATCCACATGATGGTGGATGGATGGAATGAACGAAGTGAAGAAAAACAGTGAGAAACCCATACCCAGTCATCATCGGTACACCCTGGCCATTCTTTTGTCTGGCAGGTGTCTT
-/GAATCATGGACAAAAATGTCTTGAAG GTGCCTTGAAGCCGTGCTCAATAGGACGAGCGCCTCTAGGGTTCACCACTGTGTCCTCCTCGGCCTAAAAAGTAAGTACTTTATAACTACTTAGGTCTGCCAACATAGGCCATTTTAACATACAGTGCTCAGCAAATAAGTACACCCTTTTGAAAACTACTATTTTATCCATTTCTCAGTGAATGTAGTCAAGAAAATACATTTAAATTGAAACATGTCATTCCAACAAAATTTGATCTTTTTTATTATTCTATTGATTTTTAATATTAATTAAAATTTTATAATTTTTTTTTTTATTAATTTTACTATATTTTAACTAATTTTTAGACTTTGATCTCACGATTTTTTTGTCAGATTAGTTCCAGTTTTGGCTTAAATAAATACTAATCTAATGTATATGCACAAATATATTATTGTAGAGCATCCTATACACTGTAAAAAAAAATATACAGTTGAAGTCAGAATTATTAGCCCCCTTTGAATTTTATTTTCTTTTTAAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations