ZFIN ID: ZDB-ALT-191002-1
Genomic Feature: skt1
Synonyms:
Affected Genomic Regions: gipc1 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR1-gipc1
Lab Of Origin: Torres-Vazquez Lab
Location: Chr 3: 49134320 - 49134327 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 3 bp inserted / 6 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AAGGGGGTTTAATAATTTAGATTACCACTGTATATCTAATTTAATATTATATTGTACAGAAATAACATTATCAAAATAAACATAACAGCAATATTTCATATCTTCCCAATATTGTGCAGAAATAATTTTCTCCTGACACACTACAGCAGAAATAACTGACTTTAATCATTTTTAGTTAAAAAAATACTAGTGTTCAAATAATTATGGCCACCACAGTAATGCAAGCAAACATAAACACTCCTTACCTCTGTTGGAGGAATCCCAAAGGCCTCTCCTATCTTAGCATAAAGCTCACGCACGTTACTGAAGCCCTCGATACGTCCTGTGGGGCTGCCGTGAGCCAGCTGTGTGTGGAAGATCAGTCGTGGGCGCAGACTGGTGGGTGGAGGTGGTAAACCCTCATGGGCAGCTCCTTCACCCAAGCCAACCCTGCCACCATCCAGACCATCCAACCCTGAGACGTTCAGTCCAGCCCGGATGGGTTCAGCCTCCTCGTTCTC
CCAGCG/TTT
GAGACGCCTTCTTTCTGCGTCCCAATCCAAGTGGCATTTTTGGGCACTGCTGTCTTTAATGCAAAAGGTGTGTGCACAAGCTTTAATACCGTTCTTTATGTTCCCAAATCGAAGGAGAAATCTCTGCAATTCAACCCATTCAAATCTCCAGATCTATAATGCAAACAGAAACAGACTTTGATGAAAAAGTTTTAAAAATATTTTTTCGATATAAGAAAAAAAATTGAGGTAAAGTTGGTTTTATATTCACACATTCTGCCATTTTAACGGTCTGTATATTGTTTACTACACTAACTTGAATATTCAGCACATATATAATACGCAATAGCACTATTTAATTGACTGTGAACAATGTTGTACTTTGAGAGTCATTGGCTGATAATATAATTTCCCTATTTAGAATTTGCAAATAATACTTTTCTGAAATTATATCAAGGACGTCTGAATGTGTGAATATAAAAACTAAAAACGACATTTGAAAGAGATAATTGCAACTTTTA
OTHER skt1 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)