ZFIN ID: ZDB-ALT-190912-6
Genomic Feature: mk28
Synonyms:
Affected Genomic Regions: mavs (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR2-mavs
Lab Of Origin: Goll Lab
Location: Chr 13: 15194415 - 15194418 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 4 bp deleted in Exon 3 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: at position 202 (1)
FLANKING SEQUENCE (GENOMIC)
GACTGTAGAGTTGAATTTTCAACATCAAAAGTTAACAGAGCAGAGATTAAGGTTCCTTGACAATTCACTACTGTAAAAACAAGGAAAAAACTAAATTAGGAAACGTTAATTAACAGATGTTTTTTACAGTGCAGACTTCAAAGCAAATTATGAAAAAGAAGGCCATTTTATGACTTTTCCCTTTATTTTTTGTCTATAGGTGGACCCAAACCTACAGATACTCTAGCTCCTTCTTTAACTGGAGCCACAGCAACCGTTACAACGGCAACAGTTCACACTGTCCCACCTACTACTCTTCCTCTGCTAATGCCACCTGCAGGAGATGCCCCAGTACATTCAACTGCCCCTTGCAAACAAGCAACACAGGAACCGTCTCCTGATTCTGTTCTTCAAGTTGCAGAGACACAGCAGGTGGAGCAAGTTTCTCCTCCAGCTCCGGCACCTACACCTGAACCAGTTCCCCAAACTGAAATCACACCACAAGTTATAGCACCTTCCCA
AGCA/-
GCTCCTGACATGTCCTCACCAATTAATTTAAAAGTCTTAACACACACTGGAGAAGCTGTTACCATAACACCTGTTTCTAGAGCACTAGATAGCCTTGGCTTTACAATCACCTCATCTGCTGGTGAATCTCCCATCTCCACCTCATGTACTCAAGCGTCCATCTCAAACACTTCTCAAATCCAATTGACAAGGCCTTGCTCGACCACCCAGAGCTCAGGGAATATACAGGTGCCAAAAAAAGAAGTCAAAGACTTGGACACTTCTGAGAAGTTCCCGGTCCAAGACACTAATCTCCCATTGCGACAGGAAAGAACATTTCAGGGGCCTGAAGAGACTTCCGACCCAATTGCAAATGAGGTAATAATCAACTCAAAGCACTTCACTGTTTTTCTGTGAAAAAATTGGGACAGAAGGGGTTGTCACATCAAAGATATTTAATGTAATTCCTGTAAGTATTGTCAAAAATAAGCATGTACCACAGGAACAGGGAATGGATTTAG
OTHER mk28 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Complex mavsmk28/mk28; zbtb24mk22/mk22 mavs, zbtb24

CITATIONS  (1)