Genomic Feature

bns189

ID
ZDB-ALT-190813-4
Name
bns189
Synonyms
  • hbegfaΔ7 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 14: 7050083 - 7050089 (GRCz11) (1) Details
Nucleotide change
GGGCTCG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted in Exon 3 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TTTCTGAATGAATAAAGTATTAATATTTCAAAACATTTATCACACATTTGCATGGTTTTCATTGCATAAAACACTAATAAATCAGAAAAATTAAGTTTAATGTATTTTTACTGTGTTTTCCATTTAGTGGCTGTGAGAGGTGCATCTATACCGCTTGTGTTTGAGAGCGAGAGGCCTGCGCAGACAGCTGTGATTGATTTATTGGAGGCGCTGAGTGAGAAAAGATCTACCGTGGACAACAAGCTTGTGGAATATGAGGAGGAGGATGAAGAGTATTACTATGATGATGATGTTGAAGAAGACGAGGAGGATGAGTTCTCTGGGGATTATGGGTTGCCGATAGGTAAATAATTGATGTTTGATTTCCTTTCTGTATGCTGTAGTAAAGATTTCAATGTGAATAATTACGTTTTTCCACCTAAACAGTTGCATTTTCAAGTCAACCCAAAGACCCAAGTGCGGTTTTGAACGCGGAGAAACTTGAAGGCTCAAAGAGGAAG
GGGCTCG/- GGAGAAAGAAGGGAAAAGGAAAGGGAAAAGGCAAGAAAAGAAACCCCTGTCTAAAAAAGTACAAGGACTTTTGCATCCACGGAACCTGCCAGTACTTTAGGGATTTAAAGGGGCCCTCATGCATGTAAGCACTTTCCATTTCTCCCATTATAAATGTCCAATTATAAATTCCAAATGTGTTTGACTGAAATGCTTTCCATTTCTTCCCACAGATGTGACCAGGGGTACTCAGGAGAGCGATGTCACGATTTCTCTCTGCCGGTGAAGACGAATGACGGAGGGTATGACCGCACTACAGCCCTTGCTGTGGTAGCTGTGGTTCTCTCTTCATTATGTCTGACCATCATTGGCCTCCTCCTGGCACTCAGGTTTGTTTTTAAACCACATTTTAGATGTCACAAGCAAAATTAAAAGTATTTTGAAAGTTATTTTTAATTGTTTTATGTTCAATTAACTTAAATTGGTAAAATCAATTAAGTTATTTTATCATTTTAAGTTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations