Genomic Feature

b1312

ID
ZDB-ALT-190712-1
Name
b1312
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Westerfield Lab
Current Source
Other Pages
Note
13 bp deletion in exon 12, causes frameshift followed by premature stop.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 7: 29034257 - 29034269 (GRCz11) (1) Details
Nucleotide change
ACCTGCAGCGAGG/-
Variant Notes
13 bp deletion in exon 12, causes frameshift followed by premature stop.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
13 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AATGTATATACTGTAGTTTTTTATTATTATATTATATTTTATTTTATTATGTTTTAAAATATTATATTATATTTTATAATATTACATTATATTTTATAACATTATGTTATATTGTATTGTATTCTAATATATTTTATATTATATTATTTTATATTATTGGATTATATTATATGTTATTATATTATATTATATGTTATTATATTATATTATATTATTGTATTATATTATATGTTATTATATTATATTATATGTTATTATATTATATTATATTATTTTATATTTTGTTATATTATATTTTTATCTATATTGGTCAAATATGGAAATACTCATAAGTTGCCAATCTAGTAATAAATAAATAAACGAACAAACATCAAATAATGTGAACTGTTGGAAAATTCATATCTAGAAATGTTCTGTAAATTTTTTCTTCTATTTTCCTGTGTCCAGGGAGGTGCTAGTATGCAAGTTGCGGGCGGGATATCCCGTCAGTGCTCTGCAGG
ACCTGCAGCGAGG/- GGTCAGCAGTGCCGTCAGCCTGATGCAGAGCAGCCTGCAGCAGGGCAAGATAACGAACCTCACACAAACCCTCGGCATTGAGAGCCAGGAGCAAGCCAAGAGCGCATACTTGGTGAGCATCCAGTCTGCCGACCTGTCTCATCTTATACTTTTATACTGTCAGTTTGATGTGTTTTCTGTTGTAGTTTTTGGAGTTGCTTTAATCGGTTTCCTTTGATCGTCTTCACAAATGTTTCTTGTTTGCTCAGTCTGAACGGACCCTTTTTACAAGACTGTTATGATGCGTTTCATCCGCATCTTAAATCCTTGAAAGCTTTTATTATTTAGAATTTTTTTTTTAAATGTATGAACATTTAGGTGTGTGTATTATATAATCTTGCATCAAATTACAACAAATGAATTACCGCTCATGCGAAGTGTTTCTAATGCAGCTGTCTATGGGGCAGGACAGTAAATTTGATGTTATTCTCTCTTCTGGCTGCTGTTATCAGTCTCACACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations