Genomic Feature

bns293

ID
ZDB-ALT-190403-11
Name
bns293
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
p.Glu48Gly*32
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 6: 40061376 - 40061385 (GRCz11) (1) Details
Nucleotide change
CAGTTTATTT/-
Variant Notes
p.Glu48Gly*32
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted in Exon 3 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CGTCAAAATAAAATGACCAGCTTTATAAAATTTGTTACAATTTTTCCCCACAGTTTCTTTAAACCTTTAATTATTACATTTTTTTGAAACTCACCATTTTTTAAACAAGCTCACCATATAATCTACCTATATTTACGCTGTCCTTGTCTACATCAATAGATAATAGTAAATAAATGCTTAAATGACAGATGTTTTAACTGACTACAGGCAGCTGTGTGGGAATCTCATCTGTCTCAGTGGGCAAAGAGTCCGATTCTTTGTTTGTTGTGAAGTCAGAGATGGATGAGGAGTGTTCTTGGTCCGGATCTGCAGTCTGTAGATCATTGTTGTCCTGAGGGAAGAGTTCAGGATGTTGATGGAAACACTCCTGCATGGATATGAACTGCTCCAGACAATCAGAGCCCTTCACCTCTTCTTGACTAAAGTGAAAGCAGGTAAACGCAGATTTAAACTGCTCTCCACACACTCCACTCGCCATCCCACCCAAACACGGACAGTCC
CAGTTTATTT/- CACCAGTTGGGAGGATGAGGCCTGAATGAAGAGAATGTGAAGTGGACAACAAATCCGAAATGATTATCAAGAATGAAGCATTGCTTTTTGGTGATCTTATAAAATATGCAGGTTAAGGAGCATTATCCTCTGATTATTCTCTCACCTTTTCCTTTAGGATCCCCATTTGTATCTTCCTCTTCCTGTTTCACAGTGCTGGGAGTTTCATGCTCTTCCTTAGTAATAAATATGACTTGGTCTTTCCCTTTAATGAGGTAATGGTGACATTTACAATTTGTCAAGTAAATTTAACAACTTAAAAAGAGAGTTTCACTCTTATTTCCTATCACTGGAATTAACAGTTTTAAAAAGGGGGTATATTCCTAAAGGTTTATGTTCAGACGCACACACATTCCTGTCACTAAGATTTGCAGGTGGATCCCACTTTATATCAGCTATTTTATTCACCATGTACTTAAATAAAAATAAAATAAAAATTTGCCATTATTAAAGGGATAGTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations