ZFIN ID: ZDB-ALT-190321-15
Genomic Feature: zf2070
Synonyms:
Affected Genomic Regions: stat4 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-stat4
Lab Of Origin: Zhou Lab
Location: Chr 9: 41161947 - 41161948 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
ATTTTTTTTCTCAACAATCCCATAATTTCTAAAGTATTAACCTCTACCAAATGGTTGATATGTTGGTTTATGCTAAAATACATGAATTACATTATATATTTTCATATACTATGAAAAATCTGAAAATATTAGGTGTAAGACCAATTTATTTTAAACAAACATTTTCAAAATAAAATCATGTTTGAACACTAAATCATCTTTAATTTTTCAGGTATGCATTAAAATATTTCCGATTCTCATTTAACATGTTATCTTGTTGTTTATATTTACAAATAAACCAAAATCAAGTGTAATAATGCAACAGGATTATGTTTGATGTTTTATTTTTTGTAAACCAACAATGTTGTGTAGTGTAAACCATTATTTAAAACAGCCAAAACATGGTCAACCATTTAGTAGAGCAGGCAGTTACAGGACTACTGTGTAATGGAAAAGTCAATACCTCGTCCTAAAGCATTTCTGTGTTTATCGGCTCAGGGAAACGGCATCAAACCATGAAT
CT/-
ATGGCTACTGTACTCTTCAATAACTTCCTCATTCAGCTGGAGAGACAGTGCTCTCAGGAGCAGAACTTTCTTCACAGACACAACCTGAAGAGAATATTTCATCAGATACAGGTAACATATGCCTTAACACATCTTATACATAACTGAGCGGTGAAAGCTGTTTTTATTTGCACTCTGAATGAGCGTTGCCTATCAAAAGCAGTGTTTCAGATAGTGATGCCACCGTGTGTATTTTTAGACCCCTGCTCTTTGTGTACTTGACAAAGAGAAGTGAGAGGAAAGCAAAGCGCACATAATGTCCTTGTGAATGACCCCGTGACTGTTTATCTGACCAATGCACAACTGAATGAATTTGATTACTTATATATAATACAATTAATTTAAAGGTATATTTCACCCCCCAAATTTTTATTTACTCATTATTTACATTCCCTCAAGTGGATCCAAAGTTTCTTTCTTCATGTTAACCACAAGATATTTTGAGGAAAACTGAAAACCTG
NOTES
Comment Citation
This allele has a two-base pair deletion in stat4 resulting in a  ... Meng et al., 2017
OTHER zf2070 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous stat4zf2070/zf2070 stat4 ♀+/- ♂+/-
Heterozygous stat4zf2070/+ stat4 ♀+/- ♂+/-
Complex stat4zf2070/zf2070 ; y7Tg stat4
stat4zf2070/zf2070 ; zf2071Tg stat4
stat4zf2070/zf2070 ; zf2071Tg ; y1Tg stat4
zf2072Tg ; stat4zf2070/+ stat4
zf2072Tg ; stat4zf2070/zf2070 stat4

CITATIONS  (1)