ZFIN ID: ZDB-ALT-190307-6
Genomic Feature: hu11872
Synonyms: Kcnj8_ZF.V65M (1)
Affected Genomic Regions: kcnj8 (1)
Type: Point Mutation (1)
Protocol: embryos treated with CRISPR1-kcnj8
Lab Of Origin: Bakkers Lab
Location: Chr 4: 14717694 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
FLANKING SEQUENCE (GENOMIC)
TTCAAGCGCTCTTCTGTCCGATGTGAGTGTCAGTCGGAGGCTGTAGGACAGGGATGTACCGCCCATGAGTCCAGTAGAGCAGCCCGATCTCCATCAGAAACACACATTCAGAAGCGCTTCAAACACTCACTTCTGCTCTTTTCCAGCCTTTATTCTAGAAACTGGCCCAAGAACACGGATTAAACTATTTATTGTGATCAAATCACTTTTTTTCTTATAGTTTATGCTACTTCGCCAAGTTAAACCGTGGATGCGGGATGGTTATTAAGCGCGTTTGACACGCTCAGGAGAAGTTTTTGTTGTAAATCATGTTGCCGCGGAAGAGCATCATCCCGGAGGAGTTCGCGCTGCCGGCGCTGGTGTCCCGGGTGCCGCGTAAACCAGTGTTCAGAGACCGCGTGAATAAAGCGCGCTTCATCGCCAAGAGCGGCGCGTGTAACTTGGCGCACAAGAACATCCGTGAGCAGGGCCGGTTCCTGCAGGACGTCTTCACCACTCTG
G/A
TGGATCTGAAGTGGCGCTTCACGCTGGTCATCTTCACCATGACATTTCTGTGCAGCTGGCTGCTGTTCGCCATGAGCTGGTGGCTGGTGGCCTTCGGGCACGGAGATCTGGACACCGACCGTAAACCTGCCGTGGAGCAGTGCGTCACCAATGTCAAGTGAGTGCCGTTGACTTGATTGCATGTGCAGATGTCCAAAACATGTCTATCCTCCTGTTTTGTATCTGTAGCCTATAAAACTGTTGCAAACTGATGACATATTTCATTTTATAACCTAGCCTATTTTTAAGGTATTTTATCTTCTTTTTTTTTTTAAGAAAATATACGTTTTAGGAAAATGTTTTTGTCAATACGTGGAAATATATATTTTTTATATTCAAAATAATAATTATTAAAATTATTCATTTATGGTGAATGTAATAAAAATCCAATTTAAGCAGTTTTAAAAATTATTCATAACATTGTTAAATACTTATATTAAAGGGGGAAATTACCGTCATAA
(1)
OTHER hu11872 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous kcnj8hu11872/hu11872 kcnj8 ♀+/- ♂+/-
Heterozygous kcnj8hu11872/+ kcnj8 ♀+/- ♂+/-
Complex la116Tg ; kcnj8hu11872/+ kcnj8

CITATIONS  (1)