ZFIN ID: ZDB-ALT-190123-551
Genomic Feature: sa44926
Synonyms:
Affected Genomic Regions: krit1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 46008345 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
ACCAGATGGATTATGTACATTTATTATAATTATTTCAGAATGCTTGGTGTGAATTTATAGAGGAGTGCATCTTCGTAAACTATTATAAACTAACTAAAATCTGTGAACTAGATACAATACAAATGAGAGAAAAAAGTGCAATCTTAATGACATAAGAATTAAGAAATCAAGCGTAAATCTAATGTTTTCACTACAAACAATACATCTGAACTATTCTTAAAGCTACATATGTGATTGTTTCTTGTGCCTGAATGTTATAAACTCACTTGATGTGTTTAACAGATAAACAAATACTCAATGGTTAATCTTTTGCATTAGTCTACAAGCTCTTGGTCAACAATAATCCATTCTAGACACTAAAAATTCTTCGATATGTGAATATTGCAGATGTGCACATTGTGATCTCAGTGTTAGGCAATACATTGTGCAGCTCTATTTCAAATGGACTGCTGTGTAATTCAGGAATCAAATTATTTAGTGTGCATATACTGTATATACTG
(1)
OTHER sa44926 PAGES
ZMP:sa44926 (1)
GENOTYPES No data available

CITATIONS  (1)