ZFIN ID: ZDB-ALT-190123-507
Genomic Feature: sa44881
Synonyms:
Affected Genomic Regions: myo7aa (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 18: 3442699 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
GTCATGAGTTTGAGGTCCCGATCGGAGCTGTGGTGAAGCTCTGTGATTCT
G/T
GACAGATTCAAGTTCTGGATGATGAAGGAAATGTAAGTTAATGGCCACTG
(1)
OTHER sa44881 PAGES
ZMP:sa44881 (1)
GENOTYPESNo data available

CITATIONS  (1)