ZFIN ID: ZDB-ALT-190123-506
Genomic Feature: sa44880
Synonyms:
Affected Genomic Regions: myo7aa (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 18: 3379805 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
AACCACGCAGATCTTTCACAAGGTTTACTTCCCTGATGACACAGATGAGG
T/G
CAGACTCGTTCATCTGCACAGGACAGATTGAGCTTTTCATGTGGTTCTGA
(1)
OTHER sa44880 PAGES
ZMP:sa44880 (1)
GENOTYPESNo data available

CITATIONS  (1)