Genomic Feature

b1245

ID
ZDB-ALT-181023-1
Name
b1245
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Westerfield Lab
Current Source
Other Pages
Note
ENSDART00000086201.4; c.15520_15523delinsTG; p.Ala5174fsTer, predicted to encode an usherin protein that retains the transmembrane domain but lacks the C-terminal 62 amino acids of the intracellular region including the class I PDZ binding motif.
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 17: 29378948 - 29378951 (GRCz11) (1) Details
Nucleotide change
AGGC/CA
Variant Notes
ENSDART00000086201.4; c.15520_15523delinsTG; p.Ala5174fsTer,
predicted to  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp inserted / 4 bp deleted in Exon 71 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TGATATGTAGGAAACGTGTAGGGCAAGAGGAGATTTTCCACTGGTTAATCGATCACAGATAGGAGAAATTCTGCCATTTTCTCGCAATCATGACTTTTTTTATCCTGCAATTTTGACTAAAACACGTCAGAAAAAAAAATAACCTACAAAATTTAATTTAGTGTCAGAAATATGTTTACAGTTTTTGTTTCTTAACTGTAATCCCAAGTCAACAAAAATATATCAATTAATTTATTAACTATTAATGCAGCCTAGTTTACAGTCAGTTGTTGGCAATACAAAAAATAATAATAATTTGTGTTAAATTGTGTTGTTTAAAGGGTGATTCGTTTTTTTATATTTTGCTGAAATTATCACTGCTATAATATCCCTTATGACAGAAATTTCACAGGTTTATCTCACCATTCCGCTGTCAGTGGCATGCAGGTCTGCGTCCCATGATTTCTTATCTTGAGTGTCGATCAGCTGGCTGACACTTCGATGCAGGGAATTCTGGGAGT
AGGC/CA ATGGCTCAGCTGGCTTTGACTGGGCACACGCAGCACAGACATGCTGGCCTGATAGCTGTGGTTACTGGTGCACGTACCTCCGATCTTAGTATCAGTCAAACCCTGATCAACCAAACACACAGCAGATTAATATATACAGTAGCACAAACAATCACTGCACACTTAGTCACATGCAGTAGTCAAAGAAGAACAGATAACCAAAACATGTATACATTTTGCAGGCATGCAATACCAGTTGATGGTGAAACAAAACCCAAAACATAATGGAAAGTAAGTGAAATCTCCATTATGAAATACACATTTTTTTATTTTTTCATTTAAGTTTAAGAGAGTGACTGTCAATGCAAAAAGAGAGTAAATGCCACAAAAGGCATTCATGTGTAAAGCTATTTGGTTAACACTTTACAATAAGGTTCTATTTGGTGACATTAGATAATGCTTTAACTAACTTTACAAAAAGGCTACTATATGCATTTGGTTAAAGGGTTAGTTCACCTAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations