Genomic Feature

s721

ID
ZDB-ALT-181008-4
Name
s721
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
p.R149fs*2 This mutation is predicted to remove 46% of the homeodomain as well as the complete C-terminal domain of Hhex.
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 12: 47667576 - 47667577 (GRCz11) (1) Details
Nucleotide change
-/ATGAAGTAAA
Variant Notes
p.R149fs*2
This mutation is predicted to remove 46% of the homeodomain as
well  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp inserted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TGTGTGTCCTTCTCACTAAAGTGTGTGTCTCTCACTGATGTTTATGTCTCCCTCACTAACTTGGGTGTGTGTGTCTCACACACTGATGTGTGCCAGTCCCTCTCGGTGTGTCTGTCTGTCTCTTACTAATGTGTGTGTGTGTGTGTGTCTGTCTGTCTGACTCTCTCTTACTAATGTGTGTCTATCTCGCTGATGTTTGTGTTTCTCCCTCACTAATGTGTGTGTGTGTGTGTGTCTCTATAATGTGTGTGTGTGTGTGTGTGTGTGTCTCACTGATGTGTTTGTGTGTGTGTGTCTTACTAAGTTGTGTGTGTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGATTCTCCAACGATCAAACCATCGAGCTGGAGAAGAAGTTCGAGACGCAGAAATATCTGTCTCCGCCCGAGAGGAAGAGG
-/ATGAAGTAAA CTGGCGAAGATGCTGCAGCTCAGCGAGAGACAGGTGAGAGCCACAGCACAGCATTCAGCCTTAAAACATCATTCAGACAAAAAATTATCTCACGAATCACATCTGCTTCTGTCTGCAGGTCAAAACATGGTTCCAGAACCGCCGGGCGAAATGGAGGCGCCTGAAGCAGGTGAGAATCGCGTCTTATTTACCGTCTAGTTCGGTAATGTTCATTTGTGTCAAACATGCTTCAGTGAACCAATTTTAAATATTTAATTTTTAATTAATTAGTCAAACAAGTTTACAGTTTTTTTTATTATTTAAGGGGAAATGTCTGTCAACAGTTTCAGTATTGTGTGTTTTTCAAGTGTTTTCTGTTTATTTACAGTTGTGAATTGCATTATGGGATGTTGATCTCTGCTCTGTCGATTTTTAATGTAGAAAATTAAAGTCTACAGTTTAACAAAGTGACTTTTATTGACAATTTAATAGTTTAAAATATGATGTAGGCTTTAAGAAACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations