Genomic Feature

zf1090

ID
ZDB-ALT-180910-2
Name
zf1090
Synonyms
  • -7 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 16: 4317261 - 4317269 (GRCz11) (1) Details
Nucleotide change
AGCCGCG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CCGGATGACGCGTTACTGCACGTAACATCTCACATATAGTGATATCTCACCAAATCCTTCGCTTAAGTGAGATTAAACCTTAGGATAGCAGCAGTCCCATACTATTGTTAGCCTATAAATATTCCTGTCAAAGCAGACAGCGCAACAGAAGGACCATCTCTGATTTAAGTGAAAACTTATGGTTAATATCCACATTATGAGTAACATGTTGTGCAATAGGAAGGCTTTAAAGGTCATCCATAGATGACAATAAAAAGATACAAGCTTGCTTTCTATTATAAGTAACATTAGGCTAATCGTTTTGAAACAAAGTAAGTAAATGTAAACTTTATGTAACTTATTGTAGCATATAAATGGTGTGGGCTATTGCATTTCGTCTTTAAGACGATCTCACGTTACACATTAATAATAAACAACCCCAATGCACATGAATTTCTCTCATTTCATACTGACCCCCTGAACCCTTACCTTTACAGCAGACAGATGGAGGAGAGCCGCGA
AGCCGCG/- GTATCAAATAAACAACCAAGTTCATGATTGTAATTCCAGTGGAGTGTTGCGGTGAGTCTCTGGCTCTCAAAACAATTAAGAAAGCGAAGCTGCTGGGTATGAATGAACCGAGTGTGATATCGTGGGTCAAAGTAACACATCCATTCTGCCCTTCAGATCCGAAGCACCTGCGTCGAATCCGCTAAAATTAACTTCTGGACCGCCACCCGCTCCTCCAGAGAAAAAAAAAGGATATAAATAAGAATAACAATAATAATTATAATATAAAGAAAAGTGGAAATCCACACTATCTTGGTCCTCTGCGTAATTTAAAATTAAAATCCACAGTATAACGGAAAGCCGACGTTTAATGAATCTGAATCCAAAACGTCAGAGGCAAAACAAACAAAAAGTTTCGTCCACTTCCAAGCGCAGCCTCCAGTGTGCACGCGCGTCTATAGGGCCAGAGGACGGCTTCTGCGCATATGATTATCATCAAGAGCAAAGGCTTGCTGTAAAGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations