Genomic Feature

bns2

ID
ZDB-ALT-180824-1
Name
bns2
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 11548446 - 11548451 (GRCz11) (1) Details
Nucleotide change
TCACGG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
6 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GTAAACATCATTTACACAACCATTTTCTTGTTTACTTGCAACAGTTTTTTTCACACAATAACTTTTTTTTTTATTACAAAAGCAAATAAATGATAACACAAAGTAAACAACAGACTGGCAGACATCCATAAATATCTTAAACCTAAGACCCCTCAAAAAATTCAACCATCAACACTTCATTAAACATTTCATTTAACAGTGTTTATACATACAGTTTTAAATAATAGTAAAACCCTAGAGGTGATATTTAATGTAACATGCCCTTTATTTCCTCCAGATTTTATTTGTATCAAATTTATTTCCTTTAACCTCTAAAATTAAACAAGTCAGATGCCAGTGGGTCCATTTGTCAAATGCCGTCTCATGTGCCAAAACAAAGTGCTTGTGTTCTTTTTATACCAAAAAAAGTGTTATTTTATCCATCGATAACACTGATCTGCATCCAAACCTGTCTTGAGTTTGTCCACGCAGATAAACCCACTGCCACAGTGCATTATTAC
TCACGG/- TACGAGTTTGAGTCTGGCCTAGCGCGTACCAAAAGTAATAATGGACTGTGAAGCAGTTAAAATGGCTCCTTTCTTCTCGTCAAGGCATGGCATTTGAACAGTTTAACCGATTATGTGCTTTCCAACATCGACTTTTTGCAAGTTGTAAAAATGTACCTTTCGCAGCCTTAAGGAGTAAAATATTCAGCTTTTACTATAGTAGTCCTCATCGGTGGCCCTTCTCAGAGGTTAATCCATCCATAACTGCAGAATAAATTCAATATACAATTGCAGTAACCAATAAATTTAATAAACAATGCAGTATTGGTACATTCATTCAGTAATTCATTTTCTTTTCGGCTTAGTCCCTTTATTATTCTGGGGTCGCCACAGCCAAATGAACTGCCAACTTATCCAGCATGTTTTGTGCAGCGGATACCCTTCCAGCTGCAACCCTCTACTGGAAACCATCCATACACAATCATTCACACACATATATTATGGACAATATAGCTTACCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations