ZFIN ID: ZDB-ALT-180813-4
Genomic Feature: t615B
Synonyms:
Affected Genomic Regions: alkal2b (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-alkal2b
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 17: 30664419 - 30664420 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted from position 1057 to 1058 in RefSeq:XM_002665204 in Exon 2 (1)
FLANKING SEQUENCE (GENOMIC)
GCCCTGGAAATAAACACACACACACACAAACAGATTTTAAAATAAATTCACAAACATAATGAATAATGTGCATATTAACACTTACCTACCTGTTAAATGTTTTAAAAACTTATCCTTCTGTCGAAGATCTCTCGGAAAGACCTCTGTTAAAACAGGAGAAATTCCTCAGGTTGCAATTTTTTTGGAAATGTAATGCCATATTGGTAGTCCTACAAGTATGGGCCAGTATTCACAATCTAAACACTTCTGTCAGGCATTGCATGTGATGATGCTTACCGAGAATGCGTTCATGTTGATATGACTTTGTGACTTTATTAACGTCTTTTGTTTCCAGCGAATGCTCGATGATCTGAGGAGGATGCTGTGTGTTTCCCTCACTGTGATGCTCCTGTGTCTGTCTCACTCTGTCCATTAAGAGCTCCAGCAGACTGGTTTCGTCTCTGTCTCTCGGTTTGCAGTAGCCGGTGGTGAGGATCAGCAGTAGGAGCCCTATGAAGACA
GG/-
TGGGCGCACTGCACTCATGCTGAAAGGTGGGCAAAGAGAGCCCCTCTGCCCGATGTCCAGTCTTACTGTAGCCCTGCAATAAATCATCATCGTTTCAGTTGCACTGTTGCAATCTTTATTGACATTGATGCTTCTGCTGAGAACTTTTAAGTTAGAGTTAATTAGCTTTACATTTTTAAATGGTTGCTTTTGTAGGTAAAATAAACCATGTGTGCTTTAAATATTAATCTAGGTAACATTGACATTGAGGTAATTGTAAACATTTGACATTTTCACCATTTTAAATACTTATGACAAATGTTACATAAATATTTCAGTTTATACTTTAAAAATGCTGGGTTGTTTGTAAAATACGAACAAACCAACTTGATCAAAGTTGGGTTAAAAAGTTATTTAGCATTTTCAGAATGTATGAAGTTGTAAAAGCTGCATGCATAGTAATAAAAATGATGATCAAAATCTGTTTGGGATTTATTATTACAGAAAAGCTAACTTATTAT
OTHER t615B PAGES No links to external sites

CITATIONS  (1)