Genomic Feature

rdu1000

ID
ZDB-ALT-180605-6
Name
rdu1000
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Center for Human Disease Modeling
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 11777007 - 11777010 (GRCz11) (1) Details
Nucleotide change
GCAT/-
Variant Notes
c.827_830delGCAT mutation.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp deleted in Exon 8 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ATTCAGAGAAACAGGCAGCTGGCAGCAGAGTGCATCCATTAGTGCTGATAGCAGTCTTTTACAGTGACTAAAATAGGTTTAGGAGAAGGGCTTATTAATGTACACCAAATTTGATAAATGAAGGCTTTTTGTCTAATACATTCCGGATGGGATAACTCACTCAAACATGAAAATGTACTTACTATATACTCACCATCGAGTGGTTCCAAACTTTCATGAGTTTCTTTCTTTTTGAAGAAAGCTAGAAAACCTCTAACCATTAAGTGACTTCCATAGTGTTTGTTTTTCCTACTATGGAAGTCAATGGTTACAGGTTTTTGGCTTTCTACTAAAAGCTTTTGTGTTCAACAGAAGAATAAAACTCATAAAGGTGTGGAACAAGTAAAGGATGAGTAACTGAGGGTAAAATACAATTTTTTTGTCCATCACTTTAACCCCCAGTAAATCGTTGTGTTTGTATAATATGTTGTTTTTCTGACCTACAGACTCGCCTCCTGCCC
GCAT/- GCAATCTGGCTCATCCTCAGGGATTTTTGGACCCCAGGAGCTGGGCTTCCTTAAACCATTGAACACACCGACCCACGGGACCAAGACATTACCGATCGGTATCAGATATTTGTCTTCATTTTGAATTCAAAGTAGCATTGATTTCTCATAATACCAGGCTAAAGCCATGAATCATTCTCTACTGAAGTAGATATTTCTTTTGAAAATGCAAGCAGTTCATAAATTATTTTGTAATTTCAGCAATATAAGCTAACAATTCAGCATGCTAAACAAATAACATGTTTTTGCTATACCCTATGTTAATGGATTACACATTTGAACAGGTCACAGTGTACAAACCATACGGGGATATTTGACCCAGAAATGAAAATTACTTCATCATTTATTCTCCCTCATATGGTTTAAACTCGTAGAACTATTATACCAAGAACTATTTATTTGGGCTTACAACTGTAAAACCCAACAGTGAACTTTATCAAATAAAATAAGTTTAGTTAACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations