Genomic Feature

rmc1

ID
ZDB-ALT-171205-4
Name
rmc1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Functional genomics and therapeutics / ENT
Current Source
Other Pages
Note
c.2337_2344delinsAC
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 17: 29692735 - 29692740 (GRCz11) (1) Details
Nucleotide change
TTGCAC/GT
Variant Notes
c.2337_2344delinsAC
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp inserted / 6 bp deleted in Exon 13 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
AGGTTCCACAGTCCCGGCCGTAGCGTGTGGGTAGGCAGATACACTGACCACTTACAGGGTCGCACACAGTTGCAGGCACAGTGCCTATGTGGTCACAGTAACATGGTTGACATCCATGTGTAGCGTTGGCAGAACTCAGGTTGTAGGTGTGAGCAGAGCATCGATTGCACCTTAGGCTTTCTACATTGTTTTTACACAGGCATTGGCCCGTGGTCTTGTCACACACACCTGAGCCGTTCACAGTGCCTCTGAGATCACACTGACAAGGCAAACAGCCCAAAGAGTTGCTGCGGTCCAGACTGTGGTATCCATCTCGACACACGTCACACCGCCGGCCCTCTGTGTGAGGTTTGCACTTACACTGCCCTGTTACAGCATCACAGGAGGTACCGGGAACAGATCCGTTCAGACTGCAGTTGCAGGGCAGGCAGACTCCACTGCTGTTCTGACTGTAGAAATGAGGGATGCAAGTGTCACAGAGGAGGCCCCGCACACCAGCT
TTGCAC/GT TCACACTGTCCAGTGAAGGGATTACAGAACTGGTGCAGAGAACCCCATGGGTCACAGCCACAGGAAATGCAACCATCGGGATTGGTGTGATTGAGGAATTTGAAGCCATAGTTACAACGGTCACAGGTTAGACCTAAAAATAAAACCAAAGACCATGGTCAGAAATTTCAGAAAATTCCCAGAAAGATTTAGATTCTGTTGGTGGAGAAAAAAATTATAATTTAAAAACAGATCTGTTAAAAGCTAAAATATTATAAAATAATAATAATAATAATAATAAATAGTAATTAATTGTTTAGCCTATTCTATTCACTAAATTTATTCACTGACATGTTTTTTTATTTTTTTTGTTCTTTTTTCTACTTTTATTAGATTATCATAATGATAATTTAAAAAGTATATTAATAATAATAATAATAATAATATTTATTATTATAAAGTTATTATTATTATTATTATTAGTAGTAGTAGTAGTAGTAGTAGTAAAGTAGTAGTAGTAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations