ZFIN ID: ZDB-ALT-170629-2
Genomic Feature: ouc2
Synonyms: allele2 (1)
Affected Genomic Regions: gpx4b (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-gpx4b
Lab Of Origin: Laboratory of Molecular Medicine
Location: Chr 2: 56647753 - 56647762 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted (1)
Transcript Consequence: Frameshift (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TTAATGTGTCAGACACTAAATAGACACGTCAATTTGTTTAATATAAAATTAATAGTAATCTGACCAGTTAACCGTTAATAACCGATTAATGAGCGGCGGTTGTCGGTTCGCAAAATTAACCGAAATGAGCATCCCTAATTAGGACTCACGCATACCACAAGTTGAACACCCCCTATTAACCTCTCTAACACCACTTGCAACAGCAAGCTAGTTTTTTTACCTGCTTACAGATTTCTAGTCATCACGAAGACATTAATTAGCATGTTCACGCGTGTTCGATTAGTGTTGGAGCTAAACAATGCAGGACACCGACCCTCAAGGATCAAGTTTGCCCACCCCTGCTCTATGGATAGAGACTTATTTTACATCTTGTTTAAATGCCCCTTTTTACAAATCGCTTGCAGTACATTTAAAAACAATAATAATAATAAAAAAAGTCTTCAATTGTATATTTAATGTAGTGCAGTGTAATACGCACCTGCTTTCCGAACTGGTTGCAG
TGGGCTTCCC/-
GGATGCGTAAACCCTTCTCAGCGTACGTGACGTGCATTGCCGCAAGCTGAGTGTAGTTTACTGGAGTTTTACCTCATTTAGAGGCTACGTTTGTGATGATACACACATAACCCCTGAAAAATAACACACAAACACACTTCAGACACCACGGCACAGTTTCACACACTAACATTAACCAGACGCACAATCAACAAATGTGAAGTGACTGATGGAGGCGAGGATCAGGAACAAGAGAAAGTGTGTAAATTTGCTTTTATTAGTGTAAAGTTAGATTAAACAGCGCACAGTACTTGTCATAAGTTTGACGTTTTAATTAAAACTACAGGTATTGTGAGACAAAACTGCATTTAGGTGCACAAAAATACTGTAAAAACACGCATTGCATTATTACTAAAGATTCCAGTGTCACGGGATCCTTCAAAACACAGTAGAATACATTTTAAAAGGTTTTCACAGAGAAAAATAATGCTTTATAGTAACCATTTTACTTTGGGCTGCAC
OTHER ouc2 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous gpx4bouc2/ouc2 gpx4b ♀-/-
Unknown gpx4bouc2 gpx4b ♀-/-

CITATIONS  (1)