Genomic Feature

i310

ID
ZDB-ALT-170628-2
Name
i310
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Ingham Singapore Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 10: 44220636 - 44220637 (GRCz11) (1) Details
Nucleotide change
GC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp deleted in Exon 3 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AAGTCCTCGATGGTTCACCTCGTGCATCATACTGTTATGCGATGCATTGTGTGTATGCTTTACTGAAAAGATAGGTCTTAAATGTAGTTCTGGACTGAGGACGTAATCAGGAAGGCTATTCAAGAGTTTAGGAGCCATATATGAGAAGGCTTGACCTCCTTTAGTAGACTTTGCTATTCTAGGTACTACCAGAAGCTCTGAGTTTTGAGAGTGGGTTGGATTGTAGTGAGACAGAAGGTTGGTTAGATAAACTAACCAAGACATATATATTCTTACATATAACGCTTTAAAGATTATTTAAAGCGTTATATGTAAGAAGTAATATTTTATAATCAGTGTGAGGAGAAACGGGTGAAAACAGGTTGTTGTTAGGTGCTATATAAATAATTGATCGATTGATTTGAACTCTCTACACAGCCCAGCAAACTCAGCGACAACCTAGTCCAGAATTTCCTTCTTCCCGATGAAACTCCGCCGATTCTGGAGGCCGAGATGTCGCT
GC/- GAGCGGAGCAGCCGGTGAACGGGGAGCGCGGACGGCACATCGCTATGTCAGAGAAGAAGACGTCTTCACCCAGGAGGATCATCTCACCCGAAAACCCCAAAAGCCCCAGAGCAGAAACACAGACCTGCAGTCCTGAGGTCAGTCCAGACACACACACACCGCAGAAGGAGGAGCAGGTGAAGATGCTGCAGGAAGCCCAACCCCCGAAACAGGAAGTCAAGGGCGTAAGACAGGAGCCGGAGGGTCAGATCACTGTTACTCATATGAAGGAGGAGAGCAAGGTGCCTGTGGTGAGTAGATCCAGAGTTTATTCCCAGTCCCAGTATTATCACTGGGATTCTGTTATTGGGCTTTATGTTGTTTTGTTTTGTGTTTCTAATATATATATGCACACGACAAACAGCAAGCATCAGACCGGACGTCATGTATTTCCAATGGAGAGTAGTCCGGGAGCTGCGTAGAGTTACGATCATCTCCGTATGTGGAAAATTTTGATCCGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations