ZFIN ID: ZDB-ALT-170626-4
Genomic Feature: ya327
Synonyms:
Affected Genomic Regions: mir24-4 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-mir24-4CRISPR2-mir24-4
Lab Of Origin: Nicoli Lab
Location: Chr 22: 5307498 - 5307500 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 3 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
GGCACAAATAGATTTGCTTAAACAACATGGAACAGGAAAATTAAGATTGCGTTGGTCTGAAAATAGCAACACGTCAGGAAAAACACGTCTTGCGCCTTATTGGGCCTGGTGTATAATAGGGCTCTTTATGGTTTCATTCAAACATTTAATCAGGTGTAAGTTTGGGCTGAGGATATAAGCCTTTTATTTTGGTTTATGTTTTTTAAGTTTGGTCTTAAAAATGACAAAAGTGTCCAAAAAATTAAGACTCTCTTTTTTATTTTACAAATTGAACACACCCAAAGATACGAGCAAACATACTGGTGTCGATATAGGCTCTTATGTCTTAAATCTAACCTTCAGTTAACTATAAATTGTGTGGAATTGCTTGAACTACAAAGACTTTGAACACAAGGTGTGGTGTCGTGACCATCCCTACAATTTGTCCAGACATATCCTCTCCGATTGTTCGAGTAATTGCGCTGGTGTGGTGTTGAGAAACACGACTGAGGGCTGTTCCC
ACT/-
TGTGCCTGCTAAACTGGTATCAGTATGTTGATTTAGTGCTGGCTCAGTTCAGCAGGAACAGGTGTGAAGTCCTCTACTCTCCTCCAATCAGAGTGCGCGCACAAGCATGCTTCACTTCAGCTGGAATACATCAAAATCCGTCATCAGTGAATATAAAACATGCTTTCCGAGCGACCTTGATGAAATATGAATGATTAACAAGTCAAGGCATCGAGGATAATGAATGTTTTGCATACTGATGCTGAAGCTGAACCCATATTTTTAGCATTGCTCAGCACATGAGTGACCGAGGTAATACGTAATATTGAGGTGTTCCTACCCACATACAAATCTGATATACGGCAATAGATGAAAATTACATGTATACCATAGCTTACCGCTTCATATTTGGATTTCACATATATAAAATATGTCATTAATGCAGCATATATTTTGAAATATTGCCTAAAAAAGACTGCTTACATATATATTTTTTCAACCATTAAATATACAAATATGTA
OTHER ya327 PAGES No links to external sites

CITATIONS  (1)