ZFIN ID: ZDB-ALT-170626-3
Genomic Feature: ya326
Synonyms:
Affected Genomic Regions: mir24-3 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-mir24-3CRISPR2-mir24-3
Lab Of Origin: Nicoli Lab
Location: Chr 8: 30162533 - 30162542 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TAAAGGTGGAAGAAGGGGGGGAGGGGGGTTTCTTCAAGACGAAGACAGTTGTAGAAAGAAAAAGAGGATATATATAGGAACTTAGGATCCTTTGATTGGAGAATCGTGATTAGCTAATTTGAGCCAGCTGGGTCAATCATGAGCACGTACTCCTCTCGAAATTAGTTTAATATATTAAACTTCACTTATTAGTACTATGAGATAACTCATAGAAAAGGCCAGAATTTATTTGAGCAGAATCGTTATTAGACTTCCTCCATGAAGGGATTTGTCATCATGACAGCTTGTTTTTTTTTTAAATTGAACTGTAAATGAACAAGATACATGTCTCCCAGAAGTCATGTTCAACTATTGAGGCTTAGACTCCAGTAAATTGTCAACGGAACATCTTTACGTTACGAACATCTAACATCCATTTTTCTCTTAACAGAAAATTGATGACGCAGGCGTGTGGATGAGGCTGAAGCAGCAGTGTTTGGTGGAGTTTGTGGACCAGACTC
CTGTTCCTGC/-
TGAACTGAGCCAGTGTTTGCACAGTACTGTAATCAGCTCAGTAGGCACGGGAGGCCAGCTCCATCTATCTCTCATATGACTCCCGTTCAGCTCCAGCCACTCAACAGAAGGATCTCACACGCTCTTCAGCTGAAGGTGCTTAGCACTTCATTTCCCACACAATATCTCCTAATGACATTTTAAATACGGCCCGTGCAACTAATTCCATTTTTACTAGCCTCGGATGGTAATGCATCTTTAAACAGCTTCTAAATATAGTCATTTATGGCCAGCTTCATATTTAACTCGTACATCTGTCATGACTTAGGAGGCGGTGTGCTGGCCCGCTGGCCGTCCGCTAACTCAATCTGCAGAGGTCCTTTTAAGCACAACTTCCTGTCTCGAACGCTGTCTTTCATATTTCACCCATCAAAGCTAAAAGTGGAGCTGTTTTTACAGTCCAGAGATGCAGATGTTTTGGTCTGTGTGGCCATGTCTCGCTTGGTTCCCCCTCCAATCCA
OTHER ya326 PAGES No links to external sites

CITATIONS  (1)