ZFIN ID: ZDB-ALT-170331-1
Genomic Feature: ioz9
Synonyms:
Affected Genomic Regions: gpr183a (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-gpr183a
Lab Of Origin: Liu Lab
Location: Chr 9: 31106386 - 31106396 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 11 bp deleted in Exon 2 (1)
FLANKING SEQUENCE (GENOMIC)
TACCGCAACTTTTTGATCATATACTGCAGGAGATCAACATGATATGGACTGTAGCACACGACAAACACCAGAATGACTGTACAGATCACCCCAATGGCTTTGCTGCTGCGTCCTGACTTTTCTGTCAGTTTATTGGACTTGGCCAGGTGGCGAAGTTTCAGGCAAAGTGCAGTATAGCACACTAGGATAGTGATCACAGGGATGCCGAAGCCAAGCACCACGGCACCAATGAGCATGACGGGCAAGTTGTCGATTTTCTCAAAGTTGGGATACTCCATGCATGTTATGTGACCACTTTGCTCGATGTTTGTCATGGGCATTGACAACAAAGGCAGTGTCTGCATCAACACCACGACCCAAACGACCCCACAGATGTACCGTACCTTTTGTACCTTCCGAAAGCGGGAGAATCGCAGTGGCAGTACCACTGCAATGAAGCGGTCAACACTCAAACAAGTCATGAAGTTGACTCCAGCGTACATGTTGATGTAGAACAGCAG
TGCCACAGCCT/-
TGCATAAACCCTCCCCCATAGGCCAGTCGAAACCCCTGGCGTAGTAAACCACACGTAAGGGAAGAGCAAGCGAAAACAGGATGTCCGACACTACCAGGTTGGCTGAGTACAGAGTCGTGGAGTTGATTTTCTTTAAATTTGGCCAAATGACATGCAGAGCCAGCACATTTCCCAGCAATCCAACGATGCAAATCATGGAATACATTGCAGGCAGGAAATATTGTGCCCAACCACGATGGTTATACAGGTTGGTACAGACATTTGAGTCATTCTGGGTGAAGTTTGCTGATGTTGTCTCCATGGGGTCAGTTATGAAATCTGAGAAAGGGAAAACACATATGTTACTACAGAATAGAGAGAACCCAATCAATGCCTGAACATCAGATTTGCATGTTTCAGTAAGGAAGTGCAACCAGATTGCGTCCTTTTTTAACAGGCATGCATGACAGACAAAGGAAATGCCGCAAGCCAGCTGCGGTTTCAAAACGCTCGTATACCCC
Comment Citation
deletion is at 292 base pairs after the start codon. Zhang et al., 2015
OTHER ioz9 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous gpr183aioz9/ioz9 (AB/TU) gpr183a ♀+/- ♂+/-
Complex gpr183aioz9/ioz9 ; s896Tg ; ioz1Tg gpr183a

CITATIONS  (1)