ZFIN ID: ZDB-ALT-161123-1
Genomic Feature: kg69
Synonyms:
Affected Genomic Regions: tenm3 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-tenm3
Lab Of Origin: Hindges Lab
Location: Chr 1: 39639685 - 39639698 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 14 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
CACTAGCCTAGCGGGAGGCGTACAGGAGCAGGGCAGTTTGAGAAGACTGTACGCCTCACTTCCTGTACTGTTCCACGCTTTGTGAACAATCTGTGCCACTATAACTATTCATTTAGACTTATTCAGAGTTAATATAGCAGAGCTTTCTATGAAAAGTTAAATATGCGAACGTTAAATGCTTAAACAATAAAACAGTTTCTGATTTGATGAACTGTATCCGACAAGTTTTTTTTGCCTAAAGCTCTTCAATGAAAAGTGAAAAGGATTTGAGAATGAGATTAAATATTCATTGCTCGTGTCTGTTTCTCTCTTTTTTTTTCAGGCACTTTCTCTTTAAGACAGGCACCGGCACCACTCCTCTGTTCAGCACGGCCACGCCAGGCTACACTATGGCCACGGGGGCGGTCTACTCGCCCCCCACACGGCCCCTGCCCCGCAACACACTGTCCCGCAGCGCCTTCAAGTTCAAGAAGTCCTCAAAGTACTGTTCATGGAGGTGC
ACAGCCCTCAGTGC/-
CATGGCCGTCTCCATACTGCTCTCCGTACTGCTCTGTTACTGCATTGGTAAGTTTAACACTGCCTATTACAGTATAATGCCTCATTCACACTAGCAGAGACTTTGGAGCTGCCAGTTGCTCTGGGTAGCTACCTGCTGCAAACATAGATCTATAGCATGGAAAGAACAACCAACCTCTTAGCGAGCTGAGAGAGGATCACGTGAGCTCTACTGGTGATCCTATTGGCTGTCTCTCAAGAAATTCACTTTTCATTTGCATAAAGTTAAAGGATTCTCTGTCAATCGTGTAGACAGAGGTCAGTGGGAGTCATTTACTCTCGGTTGAAATGAATGGTCGCTTATCGATTTGACAATTTGCTGCTGCAAGTCACTCATAGTGTGACTGAGGCTTTAATGGGTCAACAAGTTGAAAATCAAGTCGGTGATGTTACAGACATACACATGCACATAGATTTATTTACCAGTTTCATGACTTTCAAAACTTTGGTGTGTGTTATTGT
Comment Citation
Deletion in chromosome 1: 38,921,612 - 38,921,625.
The deletion is in the exon  ...
Antinucci et al., 2016
OTHER kg69 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tenm3kg69/kg69 (EKW) tenm3 ♀+/- ♂+/-
Complex kg1Tg ; zc60Tg ; tenm3kg69/kg69 ; mitfaw2/w2 mitfa, tenm3
mitfaw2/w2 ; kg302Tg ; tenm3kg69/kg69 ; zf456Tg mitfa, tenm3

CITATIONS  (1)