Genomic Feature

ioz100

ID
ZDB-ALT-161010-9
Name
ioz100
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Qiang Wang Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Delins
Variant Location
Chr 3: 40577253 - 40577260 (GRCz11) (1) Details
Nucleotide change
GTCCCAGT/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp inserted / 8 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
ACGGTACATCGCAGCCGACAAAGACGGCAACGTGACGGGTGACAGCGAGACCCCGGGCGAGGACTGTCGCTTCATAATCACCGCACATGATGATGGGCGCTGGTCACTGCAGTCCGAGCCGCACAAGCGCTACCTGGGCGGCACCGAGGACAGGATAACCTGCTTCGCCCAGACCATCTCCATCGCGGAGAAATGGAGCGTGCACATCGCCATGCACCCACAGGTCAACATCTTCAGCGTGACTAGAAAAAGGTACGCGCACCTGAGCTCTGAGCAGAACGAGATAGCCATCGACCGGGATGTACCCTGGGGCGTGGATTCCCTCATCACCCTGGTCTTCCAGGACCAGAGGTACCACCTTCAGACCTCCGACAACCGCTTCCTGAAGAACGACGGCAGCCTGTCCCAGACGGCGGATAAGACTACGGGTTACACGCTGGAGTTCAGGTCTGGGAAGGTGGCCTTCAGAGACTGCACCGGGAAGTACCTAGCTCCCTCTG
GTCCCAGT/C GGAACCATGAAGTCCGGCAAGAGCATGAAGGTTGGCAAGGATGAGCTCTTCGTTCTGGAGCAGAGCCATCCGCAAGTGGTCCTCACCGCTGGCAACGACAGGAATGTGTCCACCAGACAAGGTAAATGATGCCGCTTTGTTGTCGCTTAATGATGTGTTCATCCAGCAGAACGCCTGGTACATATGTGGGTATGATCAGTCAGGGTTGGGTTCCTATAAATCCTCCATAATTATCTACAGCTCATTCTAAATTATAGATATCCAGCTCTCGTGGTTGCTGTGTGCAGGGGTGGATCAGTGCAAAAGCTTTGAGCATCCTGCAGTTTAGTCGAATGTTTCCTGGAAAGATCATTTTAATGGTTAATCCGGTTGTGCATCAAAGTGAGGATCCATTTTCCCAACGCTTTTTCCTTCTGATGGTCCCAGTGGGTTATTGTCACAACAGAAATCCGTAATCTGAGAGTGAAATCAATGCTCAAGTCCCCCGTCTGCAGATTTGC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations