ZFIN ID: ZDB-ALT-161003-13340
Genomic Feature: sa27981
Synonyms:
Affected Genomic Regions: aldh18a1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 30796322 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TGCATCAGATCCTGGTAACAAACCTAGACTTCCACGACGAACAGAAAAGA
C/T
GAAACTTGAATAGCACTCTGTACGAGCTGCTGCGAATGAACATCGTTCCC
(1)
OTHER sa27981 PAGES
ZMP:sa27981 (1)
GENOTYPESNo data available

CITATIONS  (1)