Genomic Feature

um124

ID
ZDB-ALT-160721-21
Name
um124
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Lawson Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 4: 3351314 - 3351320 (GRCz11) (1) Details
Nucleotide change
CGTCATG/TTGTTGTCA
Variant Notes
2 nt deletion/5nt insertion/1 nt deletion. Introduces stop codon at aa 170.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
9 bp inserted / 7 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TTCGTGAGTACCAGCGACACCAGTGCAGTCATCAACCTGAGACCAGTCCTCTTTTTGAACCACATCTTGTTCTGGGTTTGGGGGGTGCTCTAAAACTAGATGAATCTCTTCACCGTTTTTAAGACACTGTCTGATCCAGTGGAAATCTTTAATTGCGTTGTTGCCATATAGGTATTCCTCTCTTCCGCAAACCCTTAAGACAAAATCTGATTCACTGACGTCTTCAGATATGCCTAAAAGTGCTCGCTTGTTAGTAATCTTGGCGAAGAAGCTTTGAAGTACCTGGACTGGTGTATCATCTATAGACACCTTAATAGTCTGGCTTGTTGTCTCTTTGTGTATCACCATCAGGATATGATTGTTGCTTATTTTGCTGAGCAAGTATTCAGGCATTGGTGTTGTGGTCATCCAGGGATCCATCGAATAAAGGTTGGGATCCCGATCAGATAGCTCAATTTTCCGAGGGGTCAGTAGCTTTCTTCGTGTAAACTCCAGTTCAT
CGTCATG/TTGTTGTCA GACGTTGCTGACATCGGTGACATCATATCCAATTAGATGGTTGAGAAATCGTTGGTACTGAAGCGAATCCTCAGCAGGTTGTTGCCGAACAACCAGATGGATTTTCCCTACATCTTTCCTCAACGCTTTCCAATATCTAATGCAGTCAAGGGTTTGGAATACCTGCTGTTTGTCATAGATTTCATACCAGTTGCCTTTCTTCTGATAAAGCAGGATGCAGTAGTCTGGAGAGTATTTTTGGTAAAATTCAGGGCATAACTTAGAGGTTACCGCTCTGTGCCAAAGCTGAACCTTCACCTGCTCTACCGTCCAATTTCCAGTCACGTCTAGTTGCAATGTGTCTAAAGTTTTGCTATTTTTATTGGTGGTAGGAAGTACAAACTCAACAGCTATATGTTCCATCGAGACAGCCGAGGCAGATGTAAATGCTTTCATCCTTCTCCTTCTCCTCTTGTTTTCCTCTCTGCGAACTACTGGTGGTTCATCATCACTGGCTTGCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations