Genomic Feature

um76

ID
ZDB-ALT-160721-2
Name
um76
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Lawson Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 21: 37535383 - 37535396 (GRCz11) (1) Details
Nucleotide change
CACACAGAGGTGGA/-
Variant Notes
Deletes exon splice donor site.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
14 bp deleted (1)
Transcript Consequence
Splice Site (1)
Protein Consequence
None
Sequences
Flanking Sequence
NNNNNNNATATATATAATTTGTACTTTAATCCATTTTATTCTAAGTGCTTGTAAAATGTTTGTCCCAAAAGTATTTGAAGAAAACGGTCAGCTTTTTTTTCTGTGGTGATTTGCATTGTGCGCTCTTGAGCTTGTCCGAAAACATCAACACAACGCGACTCACCCTGACGTAGATTCCCATTCTCTATTGGCCTCTTTACAGCTGTTCAATTCATGTGTTTCTTCTGTTCACATAGCTATCTGATACGTTTGGCCACATAAATACATCTCTAATATACGGATATGATTCTGCTCTTCTGATTTCTCTCTCAATCCCAGAGACAAGGTGGCTCTCAGAGCACGGTTGGCCCGGAGTTCAGCACAGCGGCTCTGATGGAGCACCTAAGAGAAAAAGAGGAGAGGATTTTGGCCCTAGAGGCCGACATGACCAAATGGGAGCAGAAATATCTGGAGGAGAGCGTCATGAGGCAGTTCGCACTGGATGCCGCTGCTTCTGTGGC
CACACAGAGGTGGA/- CACATACACTGCTCTACACTGAACATGCACTGTACAATTAGTTAGTAATTAGTTCTCAAAGTTAAAAATGACCATTGAAAAAAATGTTTGACATAAAACAATGCAAGTTTGCGAAGCATCAGTGTTAAACATCAACTGTAAAGTGCGCTACAGTGCCAATGTGGCAGTTTTTTTATTTAAAGCGACTCTCTATGATATGAAATTAAACTAAAACCCTATTTTTTAAGCCCTTTCACTTCACACTCCAAAGGTAAGGGGTAGGGGTAAAAACATTGAATTGGGCCTAAAAATTGTGATTACTATTGGATAAAAACTAAAACTCTCTGCACCAGTAAATCTAACTTTAAATTAAAGTTTTTTTTTTTTTTTTTAAATCAAGCTATACAGTGCTCAGCATTTATAAGTACACTCATCACAAATCTATCTTTTAAATTCATATTTTTAATAGGAAGCTAAACAATATTATATTTGTGCAAATACATTAGTCAGTACTTGAGCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations