Genomic Feature

y68

ID
ZDB-ALT-160707-11
Name
y68
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Weinstein Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 11: 1364028 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
mutation in the core catalytic domain of IARS
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Thr>Met at position 570 (1)
Sequences
Flanking Sequence
ATCTTCAACTTTTACTTTGTTTCCATCATTTCAGTTACTCTGTTAACTTCAACTGTTACCATCATCTCAGTTACTCTATCTTCAACTCTGTTACCGTTATCTCAGTTACCGTCATCTCTGTTTTTCTGTTACCTTCATCTCAGATATCATCATCTCAGTTAACGTTATCTCTGTTATTCTGTTACCGTCATCTCAATTACTCTAAAATAACTTCAACTCTGCTGCTTTGTTAATGTCATCTTAATAACGTTATCTCCGTTACTCTGTAAACTTCAACTACTTCAACCCTGTTACTTTCCCCTTTGTTACTTTGTTACCTCAACTGTTACTCTGTTACCTCAATACTATTATGTCAACACTCACTCTGTTATTATCAACTTTTTTACCAGAAAAAAAACCTGATCATCAGCAGAACGATTTACCTGGCCAAAACCAAACCGTTGACGATCACGTTCTTGAATGGCGGTTTCCCAAACAGAGCCGTCGAGAGCACGAGTAAC
G/A TGTAGAACCTGCAGTAAAACAACACACAAAGACAAGAGTTAAGAGACAAATCTACGACCTTAAATCTATTACAAAACTGAAAACATTCGACTGTGGTGATAAATCATTTGAGAAATCAATTATGCATCAATTCTGAAATGTACACAATGCATGGCTATTCTCTCTTGAATCCATTCTGAGCTTAGTGTTTAGCAGCAGACGGCACTCTAGGCTAGTCTTTCCTGAATTTATTTATGATCATTTTAGGTTCAGGTTAAAAAGATAAATGGATAATATTTCCCACAGCTCTGCAACTAGTACTCAACTTCAGAATAAACACATTCCTTCAACAAATAAAGATTAACAACTCTCAATCATTTTCTAAAGCAATAGACTTATCATTAACACAGCAGCTGTGTCAAGTTAGAAGCATCCCTAAATTAAACATAACTATGCATTAAAAATCCCCACACAACACTGAACAAGATTCACAACAACACAACAAGTAATCCCTATAAATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations