ZFIN ID: ZDB-ALT-160707-10
Genomic Feature: y58
Synonyms:
Affected Genomic Regions: tars1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Weinstein Lab
Location: Chr 5: 44366577 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Nonsynonymous, Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Glu>Stop at position 615 (1)
FLANKING SEQUENCE (GENOMIC)
ATATCCAGATAAAGGATGCCATCGGCAGGTATCACCAATGTGCCACCATTCAGCTGGACTTCCAGCTGCCCATTCGCTTCAATCTCACATTTGTAAGGTGTGTTTACTCAGTGAAACATTACAGCCTGTGTACAATAATGAGTGTAATCAATAAATTTGAGTGCCTAAAGGAACATCCAGGGGCTTGATTTCAGTTCCTTGTACAACAGTGACATTTTGTGGTTCTATTTGATTACTGCACTGCAAGTTGTTGATCTTTAAAACCTCATCTCTCTTCAGTCATGATGGTGATGACAAGAAGAGACCAGTGATCATCCACAGAGCCATCCTGGGCTCAGTGGAACGGATGATCGCTATCCTGACAGAAAACTATGGAGGGAAATGGTACGGTTAATAGGAAGGCTCTCACATGATGATATTTATTCCTAACTCTGCTGTATGTTCGCATAAAACATACGCCTGATTTTATTTCCCACAGGCCACTTTGGTTGTCCCCGCGT
C/T
AGGTGATGGTGGTTCCTATTGGACCCACCTGTGATGAATACGCTCAGAGAGTAAGTTTTGCTCACTATTCTTCAGACATTAGTAGCTGTTAGCTCTGATAATTTAGCTTAAGAAACATTTTGAATTATTGTCAGTGTTGTAAACAGATGTTATGATTGATATTTTAGTGTAAATTTTGTTTAAATTTATGTTGTATTCTTTAATGCATAGAAAATTCTAATGAAAAAGGTTACTTAAAATATAAATATTTAGTAGCATTGTTACAATTCCTTTACACTTGATCAGTTAAGTGCATTGTTGCTTATTAAATTTTAATTACATTAATTTATTTCACTTAAATTAAATAGTATTCCTAGTATAACTCCTTCTCCTTATTGTCATTGCTTTACAAAAGGTGCACTTTTTTATAGCTGATACTTATTTTATTAAACTTTTGACTGATTCTGATACCGATTTTTTTTTTTACACTTCCTCCCTTTTTTTTTTAAATAGATCAATAC
Comment Citation
early termination before the anticodon-binding domain of TARS Castranova et al., 2016
OTHER y58 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tars1y58/y58 tars1 ♀+/- ♂+/-
Complex tars1y58/y58; la116Tg tars1
tars1y58/y58; y1Tg tars1

CITATIONS  (1)