ZFIN ID: ZDB-ALT-160601-3278
Genomic Feature: sa34636
Synonyms:
Affected Genomic Regions: esyt3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 9: 23795131 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TCGCCTCTCTCATGGTTCTGCCCAATCGCATGTGCTTCCCTTTAATTGAT
C/T
AAGTCAAGGTTGAACAAATGAGGTTTCCTCTTCCTCGAGTAAGACTGAGC
(1)
OTHER sa34636 PAGES
ZMP:sa34636 (1)
GENOTYPESNo data available

CITATIONS  (1)