ZFIN ID: ZDB-ALT-151230-4
Genomic Feature: tsu1td
Synonyms:
Affected Genomic Regions: tgfb1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-tgfb1a
Lab Of Origin: Meng Lab
Location: Chr 15: 2803220 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp deleted in Exon 1 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ATATCTAGTGATCATCAACATCACATCGTGGGGTATATCAACACGAGTACAATAAGATTCGAATAAATTACACAAGTAGTGAATTGATTGTCTAGGATAGACTTTAAATGAATTGTGCAACCATTTTACATTCCTATCATCATAAAGCAACTCAAACACAGTTACACAATGATTATTGTTCATAATATCTGATGACAGAATGCTGACATAAACATAAACATCGAATACTACAATAAGAAGTAAAAAAAAAAGTACTTTAAATGTCTAACCTTGCTGGAAGACGAACTTATGCACCTCCTTGCCAAAATAGTCCTCATCCTCATCCTGCACAGGGACGATCTTCGTCTTCATTTCTTCGCTCAGTTCAACAGTGCTATTATATAACGAAAGCAAGGAATCCGGGATCTTCTGTCCGTCGTCGTCCGCTCCGGATTCAGGCTCTTTAGCCATGCGCAGTTTACTGAGGATCTGACCCCGAATAGCCTCAATCCGCTTCTTCC
T/-
CACCACCTCCAAATCCAGAGTCTTACAGGTGGACATGCTGCCCGTTCCCGTGACCAAACACAGGGCGGTCAGCACCAAGCAAACCAACCTCATAATGCTGAAATGTACGACCAAACTGTCCAGCGAGCAAGGAAAAAATGAAATGGAAAGGATCGAAAAGCGTCTGATTATAGAGGTGATGCTACCTGTTGAGGAGTCTGGAAAACACCTTGAATAATGGACTCAGCAGAACAGATGATGTCCGTCAATATGGGAATTTCCTAAGACCTCCATCCAGACAGAAACTAGCTTACAAGCAATTATTAGGCAAGCGCGTATATGAATAGACAGATATGGGATGAAGCCATACACAAATATGAATTCACCACACATGCATCACTGCTGGCAGTCGCACAAATGAATCATTATTCGATCTACACGGCCTGTTTTTCTTTCTATTTTAGGGTTTGGATAGTTGTGAAAACACAGAGACGCGACTGTAAGTGTGTTTACTTGCTAAC
Comment Citation
Xing et al (2015): 1bp deletion in exon 1, leads to a shift of the open reading  ... Xing et al., 2015
OTHER tsu1td PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)