Genomic Feature

mu267

ID
ZDB-ALT-151105-3
Name
mu267
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Herzog Lab
Current Source
Other Pages
Note
Helker et al (2015) : 1 base pair loss / 9 base pair insertion in exon 1 causes a\nframeshift leading to a premature stop codon and a shortening of the Apln protein to 11 AA.
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 14: 33723368 (GRCz11) (1) Details
Nucleotide change
A/TTTTCATTT
Variant Notes
Helker et al (2015) : 1 base pair loss / 9 base pair insertion in exon 1 causes  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
9 bp inserted / 1 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CACTTCCTCTCTCTCTTTCAGTGGGAGGGTTATAATAAGGAGGGTGGAGGGGAAAAGCCCCTTTTCCGTGACCCTCAGAGTCAGGGATACATAAGCAACGTGAGGGACTAGTGCTCCTTAATCCATCCCCTGATTCAAAGCAACTAGCTTCGCACTCATCCTACTGGACTTCCAATTGACAAAAGGAAAACGGGCACATCGCAGCAGGAGAACTCCAACAGAAACCTGCCCTCAATCTCAGCGGCGCTGTCACACACTTGCACACAGATATACAAACACATTCACAGCCACACACACACACAGCCGTGCGCACACACACAGACACACGCGCGCACTGAAGAGCAAACAGTCTCTCTCTCTCTCTCTCTCTCGCTCGCTCGCTCGCACTCGCTCACCCACTCTCCTCTCCCTCCCATCCACACACGCACACCACTACAGTATATCAGCTAGCGACTGGCAGGGAAACGGAGGGGAGAGCAGAAATGAATGTGAAGATCTTG
A/TTTTCATTT CGCTGGTGATTGTGCTGGTGGTTTCTCTGCTGTGTTCAGCCAGTGCTGGTAAGTCGGGAGCGTGACGGCTGTTGCCTGGAGCCTCCCCATGTTTATCTTTTTTCTCTCTGCTGTTAGCCTTGGGCTTGGGAATGGGAATGGGCAGCTGTAGTTGATCAGTTACCCAGCGTGGTTAGCCTTCTGGGGCTGGGGAGAGGAGGGAAACGGCACCTGGCTGCGCGCTGTACTGCACTGCAGAGGTTTGGCTTGTTATTGTGCCCGTTTAATGAAGTTAATTGTGCCATCCGTGGATTACTTGCCGACTTCTGCATGACATATGTAGGAAAAATCACGCAGATAAGGAGGATGATGCTGAGGGTTCTTCCTGGTGTAATGTAACGGTTGGCTTTCTAGGATTATGTACTCCTGGATGTCGTAAATGTAAGGTGTATGCCTATATAGTGTTGCGATGCATGTGGTGAGGTGTTAAAAACAGCAGATGGTTGTATAATTTGGATTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations