header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-10
Genomic Feature: sa1022
Synonyms:
Affected Genomic Regions: nol9 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 24959370 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GGTCATGTAGAAGTGCTGGGCTTCACCATAGAGGAGGGTCAACAGCCTTA
C/A
CCTGTGTTTTCACCACCGACCCACTGCCCGCTCACTATCACGGCCTTAGG
(1)
OTHER sa1022 PAGES
ZMP:sa1022 (1)

CITATIONS  (2)