Genomic Feature

fh293

ID
ZDB-ALT-120126-2
Name
fh293
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
embryos treated with ENU
Lab of Origin
Moens Lab
Current Source
Other Pages
Note
A nonsense mutation in ush1c from the Zebrafish TILLING Consortium was obtained by screening for mutations in the first PDZdomain-encoding region of ush1c (PDZ1). The line,ush1cfh293, harbors a nonsense mutation in the fifth exon, which encodes the C-terminal portion of the PDZ1 domain.
A nonsense mutation in ush1c from the Zebrafish TILLING Consortium was obtained by screening for mutations in the first PDZdomain-encoding region of ush1c (PDZ1). The line,ush1cfh293, harbors a nonsense mutation in the fifth exon, which encodes the C-terminal portion of the PDZ1 domain.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 25: 22660553 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
A nonsense mutation in ush1c from the Zebrafish TILLING Consortium was obtained  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
in Exon 5 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
AGATTTATAGCATGCATAAAACAGTAGTTAAAAGTATCTAGAGAATCTGATAGACACTTTAATATTATTACAGTGCCACAATACTGGATATATTCCATGCGTGCATATAATCCATGCACTTCCTCATTTTCCTCATTTTCTTTCGGCTTAGTCCCTTTGTTGGCTGAATGAACAGCCAACTTATCCAACATATGTTTTACACAACGGATGCCCTTCCAGCTGCAACCCAGTACATATTTCATTCATGTTACACACATACTGAATCGTGCATACTTTTATCGAAAGAAAAGAAAGAAAGTTTTAAACCGTATGCATTAGCCATTATGTATCTCACTCTGCAATTTTTTTGTTTACTATTTATTTAATTACCATTCTAAAAATTGGTTTTCTGTGTATTATTTAGGTCGGTGATGAGATTGTGCGCATCAACGGCTACTCCATCTCTTCCTGCATTCACGAGGAGGTCATCAACCTCATCAAGACCAAGAAGACTGTGTCTT
T/A GAAAGTCCGCCGTAAGATGCTTATTTTCATATTGTCACCTGTATAGTTGACTTGATTTTTTTTGTCAGTCTTTCTATTTTACTGAGCGGTACTGTCTTACATAAAGTGCCGTTTATTGGCTGCAGGGGGTGCCGATGAGCGACCCATCGAAAGTAAACAAAAAGCCACTCCAGTTTTTTTCATCTCCCTGGTGATAAACACGACGACAGACAAATAATTAAGCTATAGTTGTGCTTTTTATGAACCTATATAATTCGACAACTAAACACCAAAGCGCGTTTGTAAAAAATACATTGTATTATCTCTATTGAAGAGCAATGATCAATTCATAAATAAAAAGTGAAAATAGCCTGCTGAAGTTCCACAGATATTTTGTTCACGTTAACTTTATGAGGATTTTTTTTAACTTTAAATGCATTTTTGTCTTGTTTGCGTTATAATCTTACATTATTTAAAGTATCATATTATTACTTATAATAATTAATTCAATTCACCTTAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations